More Recent Comments

Monday, July 04, 2016

Paradigm shifting at the Royal Society meeting in November

Suzan Mazur has been making a name for herself by promoting the overthrow of modern evolutionary theory. She began with a lot of hype about the Alternberg 16 back in 2008 and continued with a series of interviews of prominent evolutionary biologists.

Now she's focused on the upcoming meeting in November as another attempt to shift paradigms [see New Trends in Evolutionary Biology: The Program]. She's not entirely wrong. Many of the people involved in those meeting see themselves as paradigm shifters.

However, one of the organizers of the London meeting made a really stupid mistake [see Censorship & Upcoming Royal Society Evo Meeting]. He wrote to Suzan Mazur saying ...
Could I request that you stop referring to the forthcoming RS-BA meeting (“New Trends in Evolutionary Biology: Biological, Philosophical and Social Science Perspectives”), and to the extended evolutionary synthesis, more generally, as in some way advocating a “paradigm shift”. Such language is both misleading (the vast majority of scientists working towards an extended synthesis do not seek revolutionary change in neo-Darwinism) and counterproductive (such talk undermines calm scientific discussion by creating an unnecessarily emotive and antagonistic atmosphere). I view the Kuhnian model as superseded long ago: the data suggests that sciences rarely if ever change through “revolutions”. Lakatos’ framework of “research programmes” offers a more up-to-date, accurate and useful conceptualization of (gradual and progressive) scientific change. The extended evolutionary synthesis is best regarded as an alternative research programme, entirely complementary to orthodox evolutionary biology. Talk of “paradigm shift” gives the false impression that the differences amongst evolutionary biologists are far more extreme than they actually are. . . .”]
The author is NOT Denis Noble, according to Mazur. It sounds very much like something John Dupré, a philosopher, would say.

Denis Noble, one of the organizers, is a founding member of The Third Way group along with Jim Shapiro. Suzan Mazur interviewed him a few yeas ago (2014) [Replace the Modern Synthesis (Neo-Darwinism): An Interview With Denis Noble]. It certainly sounds to me like Denis Noble wants to entirely replace modern evolutionary theory. He said,
I would say that it needs replacing. Yes.

The reasons I think we’re talking about replacement rather than extension are several. The first is that the exclusion of any form of acquired characteristics being inherited was a central feature of the modern synthesis. In other words, to exclude any form of inheritance that was non-Mendelian, that was Lamarckian-like, was an essential part of the modern synthesis. What we are now discovering is that there are mechanisms by which some acquired characteristics can be inherited, and inherited robustly. So it’s a bit odd to describe adding something like that to the synthesis ( i.e., extending the synthesis). A more honest statement is that the synthesis needs to be replaced.

By “replacement” I don’t mean to say that the mechanism of random change followed by selection does not exist as a possible mechanism. But it becomes one mechanism amongst many others, and those mechanisms must interact. So my argument for saying this is a matter of replacement rather than extension is simply that it was a direct intention of those who formulated the modern synthesis to exclude the inheritance of acquired characteristics. That would be my first and perhaps the main reason for saying we’re talking about replacement rather than extension.
I suppose we could quibble about the term "paradigm shift" but I've heard Denis Noble speak (Boston 2015: Physiologists fall for the Third Way ) and he has harsh words to say about evolutionary biologists and molecular biologists. He is a physiologist [see A physiologist thinks about evolution] and he has a very different view of evolutionary biology.

If he gets his way, evolutionary theory will look nothing like it does today. If that's not a paradigm shift then I don't know what is.

Kalevi Kull is an evolutionary biologist at Tartu University in Estonia. He plans to attend the meeting. He also made the mistake of writing to Suzan Mazur and she has published his letter in Kalevi Kull: Censorship & Royal Society Evo Event. Kull thinks there IS a paradigm shift going on. He wrote,
Well, I really interpret the letter you refer to in your article [“Censorpship & Upcoming Royal Society Evo Meeting“] as evidence that this IS a paradigm shift. Because it focuses not on the biological theory itself, but on social matters in academia. And this is a serious hint. Because if this kind of deep change happens, then very many scientists face a problem of how to survive this change because the new dominant model they would like to accept results in many of their previous writings losing much of their value. Nobody wants to belong to the party of losers. One of the best strategies in such a case is evidently an interpretation of the change as a gradual accumulation of knowledge while their work has always been at the cutting edge.

Is this a radical change in biology what is going on now? The contrast is quite clear, if we look at how evolutionary innovation is described. Either innovation begins from a new mutation, followed by newly behaving phenotype, which is amplified by natural selection (this is what the neo-Darwinian model suggests), or innovation begins from a change of function (with habitat choice, or resource choice, etc.) first stabilised by epigenetic or ecological inheritance and followed by fixation due to mutational noise (which is what the new model states, let us call it the post-Darwinan model).

That is: either a genetic change first, followed by functional change, or a functional (epigenetic, i.e., non-genetic) change first, followed by genetic changes.

The details of this contrast are described, for instance, in my work “Adaptive Evolution without Natural Selection“ published in the Linnean Society journal. . . but there are many scholars who share this model. That paper provides a row of references. Isn’t it a deep contrast, and a possible move from one to another, a radical change of the major model of evolution?

...

Science, deeply speaking, is the mutual help in understanding. We should help each other as friends; nobody is understanding everything. Keeping this in mind, the best way to make our thoughts clear is to use formulations that do not hide meaning. A better understanding is not always an extension of the earlier model, sometimes it is an alternative.

In other words — summarizing — claiming that what is going on is just an ongoing extension of Darwinism would be equivalent to saying that Einsteinian physics is just an extended Newtonianism. Why not, one may describe it so. However, the Einsteinian change became a classic example of a paradigm shift, for Kuhn. . . .

I like very much your writings.
It looks to me like the organizers of this meeting didn't think very carefully about the can of worms they were opening. When you have speakers like Denis Noble and Jim Shapiro you are just inviting trouble. When you try to lecture Suzan Mazur about paradigm shifting you are bound to regret it.

I'm beginning to think this meeting isn't going to happen. The Royal Society is going to end up looking very bad and there's no easy way to fix the problem short of cancelling the meeting.


48 comments :

Anthony said...

In the quote above Kull writes,

"Science, deeply speaking, is the mutual help in understanding. We should help each other as friends; nobody is understanding everything. Keeping this in mind, the best way to make our thoughts clear is to use formulations that do not hide meaning."

Ok so far, but then he says,

"A better understanding is not always an extension of the earlier model, sometimes it is an alternative."

How does this follow from what he just said? It doesn't.

bigdipper said...

NeoDarwinism is not Darwinism.

CrocodileChuck said...

From BREXIT -> Royal Society's Meeting on Evolutionary Biology:

When it rains, it pours

Joe Felsenstein said...

So the whole point of the meeting is to settle a semantic question: yes, there's all these interesting phenomena, some of them new. But do they create the need to declare a New Theory? Or a New Paradigm? And, if so, which of the speakers gets the credit for it?

Robert Byers said...

Canceling the meeting after all the acceptance by speakers would be a paradigm shift in any remaining credibility of institutions dealing with origin issues.
The meeting going ahead is a defeat for NOTHING TO SEE HEAR FOLKS.
Canceling would be saying there is something to see and its uniquely dangerous.
Why miss a paradigm shift or staying in gear ? Something exciting.

Ome shouldn't proclaim a paradigm shift before its happened. yet evolutionism is very contentious in human civilization and so new ideas even amongst its believers does matter.
What If Susan Mazur is right? She will get the credit for insight.
If some speakers really do see a big change is needed then this is the place to introduce it to interested persons.
AS a YEC I support this meeting going forward. ID folks do too.
if nothing new or persuasive then no need to fear a paradigm shift.

Rolf Aalberg said...

In contrast to Kalevi Kull, I say about Suzan Mazur:
I dislike very much your writings.

Suzan Mazur strikes me not as a reporter but a person with an agenda. I think I see a pecuniary motive.

Unknown said...

I think the biggest issue with what Kull writes is this:
Because if this kind of deep change happens, then very many scientists face a problem of how to survive this change because the new dominant model they would like to accept results in many of their previous writings losing much of their value. Nobody wants to belong to the party of losers.

This displays a fundamental misunderstanding of what differentiates a good scientist from a bad scientist. Kulls view implies that a good scientist is one that supports correct hypotheses early. A bad scientist then is one who supports incorrect hypotheses. But science ultimately relies upon erecting numerous hypotheses and then testing them. Having a hunch that hypothesis A might be correct when the evidence supporting it over hypothesis B is equivocal and later being vindicated doesn't make you a good scientist, it just makes you lucky. The actual contribution of a scientist is not their opinion - however informed - on whether A or B is to be preferred, but their work in figuring out how to conduct research that can inform us which of the two are more in line with nature. Being wrong quite frequently is just an ordinary side effect of doing science.

Mikkel Rumraket Rasmussen said...

What a lovely clusterfuck by a bunch of big-egoes out to have their pet interpretation become the Next-Big-Idea.

Joe Felsenstein said...

At least 5 of the speakers are among the 57 people who have agreed to have themselves listed on the Third Way of Evolution website. The difficulty with the definition of the Third Way is that each person has a different Way that they want to go. The jump on their horse and "gallop madly off in all directions". The meeting will probably be something like that.

Each of these 57 people seems convinced that their Way is the way that will be agreed on. The meeting may have many people like that.

Mikkel Rumraket Rasmussen said...

Clearly, clearly I say, the 38th way is The One True and Correct way of evolutionary theory. I shall call it Mikkelialism.
And they saw that it was good.

Joe Felsenstein said...

typo in my comment. Should read "they jump on their horse ..." This is of course a famous image by Canadian humorist Stephen Leacock.

Anonymous said...

Exactly the feeling I get.

Unknown said...

And Iceland beating England in soccer (football). The perfect storm.

Unknown said...

But I am sure that she would get along fine with Denyse O'Leary.

ElShamah777 said...

Proponents of evolution fear any move forward that puts their pet theory in danger. Darwins holy cow cannot and shall not be sacrified, by no means !! Otherwise, a designer could become tenable. That would equal to a death sentence. No Dawin, no funding, no money, no honey, and most brilliant science papers about evolution become toilet paper......

Larry Moran said...

Take your meds before posting comments on my blog.

Les said...

Jeffrey Shallit summarizes Susan Mazur:

http://recursed.blogspot.com/2010/02/susan-mazur-perpetually-clueless.html

Nullifidian said...

Suzan Mazur strikes me as very much the type of ignoramus-cum-contrarian who doesn't understand the existing theory and hopes that there will soon be something replacing it that she can understand.

Unknown said...

"Otherwise, a designer could become tenable. "

It isn't Darwin or modern evolutionary theory that makes ID untenable. It is ID's inability to articulate any testable hypotheses, discuss the nature of the designer and the mechanisms he used to realize his design, and the overall lack of any research that makes ID untenable.

ElShamah777 said...

Magna,

as it seems, you are not well informed:

Following a list of predictions of intelligent design theory, and its confirmation:

Predictions in biology:

- High instructive coded information content will be found throughout the genome, in " junk DNA", and the epigenome– (already proven)
- The non-adequacy of the DNA-centric view to explain biodiversity. Proven. We know that Membrane targets and patterns, Cytoskeletal arrays, Centrosomes, Ion channels, Sugar molecules on the exterior of cells (the sugar code), Gene regulatory networks, the Splicing Code, the Metabolic Code, the Signal Transduction Codes, the Signal Integration Codes, the Histone Code, the Tubulin Code the Sugar Code and the Glycomic Code define morphology, development, cell and body shape. Basically, macroevolution ( the origin of morphological novelties ) is a falsified prediction, while ID is confirmed.
- Machine-like irreducibly complex structures will be found – (already proven, and a undeniable fact. Ken Millers rebuttal is not a compelling refutation )

- Forms will be found in the fossil record that appear suddenly and without any precursors – ( well known)

- Genes and functional parts will be re-used in different unrelated organisms – ( proven)
- The genetic code will NOT contain much discarded genetic baggage code or functionless “junk DNA” – (being proven over & over today)
- Few or no intermediate forms will found giving a clear and gradual pathway from one family to another. There are none so far.
- Mechanisms for error detection and correction will be abundant within the genome of all organisms – (already proven)
- Mechanisms for *non-random* adaptations, coherent with environmental pressures, will be found (already found)
- So called vestigial organs will be found to have specific purpose and usefulness – (already proven)
- Few mutations will end up being beneficial in the long run – (already proven)
- Genetic entropy will be found to cancel our most if any beneficial mutations

In astronomy/astrophysics

- an increase (and not a decrease), as science progresses, in the number of finely-tuned parameters pertinent to the laws and constants of physics

Predictions in Paleontology

- The observed pattern of the fossil record whereby morphological disparity precedes diversity
- Saltational, or abrupt, appearance of new life forms without transitional precursors

ID theory in order to remain in the domain of science does not make any claims about the identity of the designer. That is in the realm of philosophy and theology

The mechanism is , to cite Ann Gauger, intelligence. Conscious activity. The deliberate choice of a rational agent. Indeed, we have abundant experience in the present of intelligent agents generating specified information. Our experience of the causal powers of intelligent agents -- of "conscious activity" as "a cause now in operation"-- provides a basis for making inferences about the best explanation of the origin of biological information in the past. In other words, our experience of the cause-and-effect structure of the world -- specifically the cause known to produce large amounts of specified information in the present -- provides a basis for understanding what likely caused large increases in specified information in living systems in the past. It is precisely my reliance on such experience that makes possible an understanding of the type of causes at work in the history of life.

Bill Cole said...

EL77
"The mechanism is intelligence , to cite Ann Gauger, intelligence"

Intelligence is an inference not a mechanism, per a conversation with Michael Behe. According to Behe it is the best inference that fits the observation of the micro machines we observe in the cell.

judmarc said...

According to Behe it is the best inference that fits the observation of the micro machines we observe in the cell.

Except on a witness stand, sworn under oath to tell the truth, and presented with a foot-high stack of books and papers that contradicted the "facts" he drew his inference from, he forthrightly told the court that no matter how many times his supposed "facts" were contradicted, it would not change his conclusion.

Doesn't sound scientific to me, Bill. Sounds like a desired conclusion unshakable by facts.

Mikkel Rumraket Rasmussen said...

Notice how all of Elshamah's "predictions" are ad-hoc rationalizations. There is no mechanistic or logical theory behind it from which any of them actually flow.

From what theory of design does this "there should be a code" idea come from and in what publication that predates the discovery and elucidation of the genetic code can I see this being predicted by design theorists? (Hint: none).

ElShamah777 said...
This comment has been removed by a blog administrator.
Mikkel Rumraket Rasmussen said...

How much CSI is there in this intelligently designed DNA sequence?:

AAAGGGCCCTTTAAGGCCTTAGCT

Compute it for me and Show your work (as the math teacher would say).

ElShamah777 said...
This comment has been removed by a blog administrator.
ElShamah777 said...
This comment has been removed by a blog administrator.
ElShamah777 said...
This comment has been removed by a blog administrator.
Anonymous said...

Not ElShamah777 again. "I don't believe chemistry, random changes, plus selection are enough" at great length. Sigh.

Mikkel Rumraket Rasmussen said...

Elshamah, why did you change the subject?

How much CSI is there in this intelligently designed DNA sequence?:

AAAGGGCCCTTTAAGGCCTTAGCT

Compute it for me and Show your work (as the math teacher would say).

Unknown said...

no idea. LOL.

does it instruct for something specific ?

Chris B said...

Otangelo,

"no idea. LOL."

We already know that, you have demonstrated it over and over again.

You are being asked to provide a positive quantitative argument in favor of your baseless claims. Something ID/creationists have never been able to do.

Unknown said...

Chris B

take your blinkers off, and you will see.

Ed said...

That doesn't answer the question Otangelo. Care to have another go? Or will you keep on evading the question?
How much CSI is there in this intelligently designed DNA sequence?:
AAAGGGCCCTTTAAGGCCTTAGCT

Compute it for me and Show your work (as the math teacher would say).


Keep on evading the question and it's clear you have not a single clue about what you're claiming.

Unknown said...

Ed

the question and the challenge is moot, and questions something where there should be no dispute ( except by non educated proponents of naturalism, that try to argue, that the DNA sequence does not operate as a true code)

http://www.ncbi.nlm.nih.gov/pubmed/8335231

The genetic language is a collection of rules and regularities of genetic information coding for genetic texts. It is defined by alphabet, grammar, collection of punctuation marks and regulatory sites, semantics.

the sequence our friend posted, can have coding function or not. What is the point ?

Chris B said...

Otangelo,

"the question and the challenge is moot,"

Take your blinkers off, Otangelo. You can't prove anything your claim, and you can't meet the most basic of challenges presented to you here:

to define in any meaningful way what you claim.

Unknown said...

" you can't meet the most basic of challenges presented to you here "

Got ya what your aim is.

Nothing new here.

Unknown said...

EL77: "The mechanism is , to cite Ann Gauger, intelligence."

Really? Let's test this claim. Build me a car using only your brain.

SRM said...

AAAGGGCCCTTTAAGGCCTTAGCT

What's the issue here Otangelo? Is it that CSI cannot be calculated, or that you simply don't know how to do it?

Unknown said...

well, i could take a codon table, and check what amino acids the sequence codes for. And then try to figure out if it relates to a specific protein amino acid chain. After i would find that out, so what ? Is Mikkel questioning, that the genetic code does or does not code for proteins ? as said. I still dont get the challenge. What is this about ?

Chris B said...

Otangelo,

"" you can't meet the most basic of challenges presented to you here "

Got ya what your aim is.

Nothing new here."

Yes, you are presenting nothing new here.

After saying that you understand the challenge, you then say:

"Is Mikkel questioning, that the genetic code does or does not code for proteins ? as said. I still dont get the challenge. What is this about ? "

Are you still just avoiding the question?

SRM said...

well, i could take a codon table, and check what amino acids the sequence codes for.

That surely wouldn't be sufficient. The sequence as shown potentially codes for 8, 6, or 3 amino acid peptides. But there is a lot more to DNA sequence than coding proteins in any case. My understanding is that the question pertains specifically to calculating the complex specified information of the sequence.

nmanning said...

No need to go through all of these DI-hacked 'predictions', as others have pointed out, they all seem to be post-hoc rationalizations. But just this one:

"- Mechanisms for error detection and correction will be abundant within the genome of all organisms – (already proven)"

I suppose this stems from the "work" of 'Mike Gene', of the old ARN forum fame. He claimed to have, using ID concepts, 'predicted' transcriptional proof-reading, then looked in the literature, and VOILA! - found it, thus, ID prediction fulfilled.
Problem was, he had recently written an ARN post on translational proofreading. One of the participants at the time (this was many years ago) did a search for 'proofreading' and the articles that Mike Gene used came up in the search - in other words, Gene simply saw those papers while writing his post, then later decided to pretend to have made a 'prediction.'

Pretty pathetic, but anti-'Darwininsts' go with what they have.

nmanning said...

I noted that many of the 'third way' associates are not even close to having relevance in the related science. It almost reads like a miniature 'Dissent from Darwin' list.

O Cabrito Politico said...

Of course, Darwinian theory and Modern Synthesis need be extended, from the Earth surface where it is based, towards the Cosmos, which produced the natural phenomena of evolution ( from singularity to complexity). Matrix/DNA Theory is trying to do it - linking biological evolution to cosmological evolution - and getting surprising results that shows the Modern Synthesis is not complete.

THeFiSH said...

For some reason, tonight, I just started reading scientific articles about evolutionary biology. I was prompted by a yahoo link to an article discussing the Royal society meeting in Nov. I followed some other links and eventually landed here.

I am not a scientist. I'm definitely more philosophically minded(which is primarily why I read articles rather than scientific journals more often than not). That being said, the reason I feel compelled to comment here is that I don't see ID and evolution to be diametrically opposed on a fundamental level. It seems to me that egos are the main barriers to mutual understanding. I don't see anyone proposing the question of why it has to be one or the other.

Aren't religion and science, more or less, flip-sides of the same coin? Do not both serve the same purpose, that is to more fully understand the universe and our role in it? When practiced without ego or greed, shouldn't one act as a catalyst to seek a greater understanding of the other? If the answer to these questions is affirmative, then wouldn't it better server the common good of all if scientists and theologians would be more willing to re-evaluate and expand upon what they think they know when there's a contradiction?

I'm convinced that the perpetual "us and them" mentality of even the most well meaning of people is one of the main roadblocks to true human progress, material as well as spiritual.

John Harshman said...

Aren't religion and science, more or less, flip-sides of the same coin? Do not both serve the same purpose, that is to more fully understand the universe and our role in it? When practiced without ego or greed, shouldn't one act as a catalyst to seek a greater understanding of the other?

No, no, and no. There is no religious "way of knowing". Religion provides no insights about the world or our place in it. Religion has nothing to contribute to science, and it's fruitless, in the truest sense of the word, to pretend otherwise. I know you would like to believe otherwise, but it just ain't so.

THeFiSH said...

I understand why a person would feel this way, especially one who has devoted his life to the study of the material universe. I don't quite agree with the idea that there is no religious way of knowing, however. One can know immaterial truth in the same way that one can know that when a tree falls with nothing Present to hear, it does indeed make a sound. Proving this scientifically is impossible, but it is a reasonable conclusion to the question nonetheless.

My comment wasn't meant to advocate for or against religion. What I'm curious about is, since there is no way to prove deity or lack thereof, the existence of God is entirely in the realm of possibility. If the purpose of science is to explain the how's, then the purpose of objective theology is to explain the why's. So discovery in one area should lead to a greater desire for knowledge in the other. Studying various religions and philosophies has certainly contributed to my interest is science. How about Thomas Aquinas who contributed to defining the scientific method, or Georges Lemaître who first proposed the expanding universe model?

I would add that in my experience, I have found the people who most adamantly deny the possibility of a creator, use "fundamentalist" Christian examples to support their positions. I haven't found one argument against a created universe where the professor had done any sort of objective theological study even on an elementary level. So to say religion is fruitless because...science, is the other extreme to the "science is wrong because the bible says..." argument. Flip sides of the same coin if you will.