tag:blogger.com,1999:blog-37148773.post3431096504783161665..comments2024-03-27T14:50:47.345-04:00Comments on <center>Sandwalk</center>: Paradigm shifting at the Royal Society meeting in NovemberLarry Moranhttp://www.blogger.com/profile/05756598746605455848noreply@blogger.comBlogger48125tag:blogger.com,1999:blog-37148773.post-21939349806291061032016-12-15T23:47:29.204-05:002016-12-15T23:47:29.204-05:00I understand why a person would feel this way, esp...I understand why a person would feel this way, especially one who has devoted his life to the study of the material universe. I don't quite agree with the idea that there is no religious way of knowing, however. One can know immaterial truth in the same way that one can know that when a tree falls with nothing Present to hear, it does indeed make a sound. Proving this scientifically is impossible, but it is a reasonable conclusion to the question nonetheless. <br /><br />My comment wasn't meant to advocate for or against religion. What I'm curious about is, since there is no way to prove deity or lack thereof, the existence of God is entirely in the realm of possibility. If the purpose of science is to explain the how's, then the purpose of objective theology is to explain the why's. So discovery in one area should lead to a greater desire for knowledge in the other. Studying various religions and philosophies has certainly contributed to my interest is science. How about Thomas Aquinas who contributed to defining the scientific method, or Georges Lemaître who first proposed the expanding universe model?<br /><br />I would add that in my experience, I have found the people who most adamantly deny the possibility of a creator, use "fundamentalist" Christian examples to support their positions. I haven't found one argument against a created universe where the professor had done any sort of objective theological study even on an elementary level. So to say religion is fruitless because...science, is the other extreme to the "science is wrong because the bible says..." argument. Flip sides of the same coin if you will.THeFiSHhttps://www.blogger.com/profile/02044351905588048215noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-69799089710925804802016-12-14T09:41:27.615-05:002016-12-14T09:41:27.615-05:00Aren't religion and science, more or less, fli...<i>Aren't religion and science, more or less, flip-sides of the same coin? Do not both serve the same purpose, that is to more fully understand the universe and our role in it? When practiced without ego or greed, shouldn't one act as a catalyst to seek a greater understanding of the other?</i><br /><br />No, no, and no. There is no religious "way of knowing". Religion provides no insights about the world or our place in it. Religion has nothing to contribute to science, and it's fruitless, in the truest sense of the word, to pretend otherwise. I know you would like to believe otherwise, but it just ain't so.John Harshmanhttps://www.blogger.com/profile/04478895397136729867noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-85855930761139293872016-12-14T02:25:34.903-05:002016-12-14T02:25:34.903-05:00For some reason, tonight, I just started reading s...For some reason, tonight, I just started reading scientific articles about evolutionary biology. I was prompted by a yahoo link to an article discussing the Royal society meeting in Nov. I followed some other links and eventually landed here. <br /><br />I am not a scientist. I'm definitely more philosophically minded(which is primarily why I read articles rather than scientific journals more often than not). That being said, the reason I feel compelled to comment here is that I don't see ID and evolution to be diametrically opposed on a fundamental level. It seems to me that egos are the main barriers to mutual understanding. I don't see anyone proposing the question of why it has to be one or the other.<br /><br />Aren't religion and science, more or less, flip-sides of the same coin? Do not both serve the same purpose, that is to more fully understand the universe and our role in it? When practiced without ego or greed, shouldn't one act as a catalyst to seek a greater understanding of the other? If the answer to these questions is affirmative, then wouldn't it better server the common good of all if scientists and theologians would be more willing to re-evaluate and expand upon what they think they know when there's a contradiction? <br /><br />I'm convinced that the perpetual "us and them" mentality of even the most well meaning of people is one of the main roadblocks to true human progress, material as well as spiritual.THeFiSHhttps://www.blogger.com/profile/02044351905588048215noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-3879196550470763342016-12-05T00:53:00.552-05:002016-12-05T00:53:00.552-05:00Of course, Darwinian theory and Modern Synthesis n...Of course, Darwinian theory and Modern Synthesis need be extended, from the Earth surface where it is based, towards the Cosmos, which produced the natural phenomena of evolution ( from singularity to complexity). Matrix/DNA Theory is trying to do it - linking biological evolution to cosmological evolution - and getting surprising results that shows the Modern Synthesis is not complete.O Cabrito Politicohttps://www.blogger.com/profile/04974880234487680749noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-17836212277565481032016-07-28T08:52:12.372-04:002016-07-28T08:52:12.372-04:00I noted that many of the 'third way' assoc...I noted that many of the 'third way' associates are not even close to having relevance in the related science. It almost reads like a miniature 'Dissent from Darwin' list.nmanninghttps://www.blogger.com/profile/14767343547942014627noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-5028201492930123422016-07-28T08:49:35.102-04:002016-07-28T08:49:35.102-04:00No need to go through all of these DI-hacked '...No need to go through all of these DI-hacked 'predictions', as others have pointed out, they all seem to be post-hoc rationalizations. But just this one:<br /><br />"- Mechanisms for error detection and correction will be abundant within the genome of all organisms – (already proven)"<br /><br />I suppose this stems from the "work" of 'Mike Gene', of the old ARN forum fame. He claimed to have, using ID concepts, 'predicted' transcriptional proof-reading, then looked in the literature, and VOILA! - found it, thus, ID prediction fulfilled.<br />Problem was, he had recently written an ARN post on translational proofreading. One of the participants at the time (this was many years ago) did a search for 'proofreading' and the articles that Mike Gene used came up in the search - in other words, Gene simply saw those papers while writing his post, then later decided to pretend to have made a 'prediction.'<br /><br />Pretty pathetic, but anti-'Darwininsts' go with what they have.nmanninghttps://www.blogger.com/profile/14767343547942014627noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-73088213135802866712016-07-10T15:40:47.732-04:002016-07-10T15:40:47.732-04:00well, i could take a codon table, and check what a...<i>well, i could take a codon table, and check what amino acids the sequence codes for.</i><br /><br />That surely wouldn't be sufficient. The sequence as shown potentially codes for 8, 6, or 3 amino acid peptides. But there is a lot more to DNA sequence than coding proteins in any case. My understanding is that the question pertains specifically to calculating the complex specified information of the sequence.SRMhttps://www.blogger.com/profile/07299706694667706149noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-4113390592082613502016-07-10T14:09:57.005-04:002016-07-10T14:09:57.005-04:00Otangelo,
"" you can't meet the mos...Otangelo,<br /><br />"" you can't meet the most basic of challenges presented to you here "<br /><br />Got ya what your aim is.<br /><br />Nothing new here."<br /><br />Yes, you are presenting nothing new here.<br /><br />After saying that you understand the challenge, you then say:<br /><br />"Is Mikkel questioning, that the genetic code does or does not code for proteins ? as said. I still dont get the challenge. What is this about ? "<br /><br />Are you still just avoiding the question?Chris Bhttps://www.blogger.com/profile/04778164246719803780noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-5896292026789401092016-07-10T10:58:24.931-04:002016-07-10T10:58:24.931-04:00well, i could take a codon table, and check what a...well, i could take a codon table, and check what amino acids the sequence codes for. And then try to figure out if it relates to a specific protein amino acid chain. After i would find that out, so what ? Is Mikkel questioning, that the genetic code does or does not code for proteins ? as said. I still dont get the challenge. What is this about ? Anonymoushttps://www.blogger.com/profile/05265343573323745994noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-4252959993404312582016-07-10T06:18:38.944-04:002016-07-10T06:18:38.944-04:00AAAGGGCCCTTTAAGGCCTTAGCT
What's the issue her...<i>AAAGGGCCCTTTAAGGCCTTAGCT</i><br /><br />What's the issue here Otangelo? Is it that CSI cannot be calculated, or that you simply don't know how to do it?SRMhttps://www.blogger.com/profile/07299706694667706149noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-64462245361023409442016-07-09T23:26:59.398-04:002016-07-09T23:26:59.398-04:00EL77: "The mechanism is , to cite Ann Gauger,...EL77: <i>"The mechanism is , to cite Ann Gauger, intelligence."</i><br /><br />Really? Let's test this claim. Build me a car using only your brain. Anonymoushttps://www.blogger.com/profile/07522681149878283124noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-5166227610308347642016-07-09T20:15:59.950-04:002016-07-09T20:15:59.950-04:00" you can't meet the most basic of challe..." you can't meet the most basic of challenges presented to you here " <br /><br />Got ya what your aim is. <br /><br />Nothing new here. Anonymoushttps://www.blogger.com/profile/05265343573323745994noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-68743822089905214232016-07-09T19:55:10.860-04:002016-07-09T19:55:10.860-04:00Otangelo,
"the question and the challenge is...Otangelo,<br /><br />"the question and the challenge is moot,"<br /><br />Take your blinkers off, Otangelo. You can't prove anything your claim, and you can't meet the most basic of challenges presented to you here:<br /><br />to define in any meaningful way what you claim.Chris Bhttps://www.blogger.com/profile/04778164246719803780noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-70511998510763199562016-07-09T12:32:37.511-04:002016-07-09T12:32:37.511-04:00Ed
the question and the challenge is moot, and qu...Ed<br /><br />the question and the challenge is moot, and questions something where there should be no dispute ( except by non educated proponents of naturalism, that try to argue, that the DNA sequence does not operate as a true code) <br /><br />http://www.ncbi.nlm.nih.gov/pubmed/8335231<br /><br />The genetic language is a collection of rules and regularities of genetic information coding for genetic texts. It is defined by alphabet, grammar, collection of punctuation marks and regulatory sites, semantics.<br /><br />the sequence our friend posted, can have coding function or not. What is the point ? <br /><br />Anonymoushttps://www.blogger.com/profile/05265343573323745994noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-69115194936422978192016-07-09T11:28:05.767-04:002016-07-09T11:28:05.767-04:00That doesn't answer the question Otangelo. Car...That doesn't answer the question Otangelo. Care to have another go? Or will you keep on evading the question?<br /><i>How much CSI is there in this intelligently designed DNA sequence?:<br />AAAGGGCCCTTTAAGGCCTTAGCT<br /><br />Compute it for me and Show your work (as the math teacher would say). </i><br /><br />Keep on evading the question and it's clear you have not a single clue about what you're claiming.Edhttps://www.blogger.com/profile/15924368353226400878noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-58270401855834472992016-07-09T07:59:36.182-04:002016-07-09T07:59:36.182-04:00Chris B
take your blinkers off, and you will see....Chris B<br /><br />take your blinkers off, and you will see. Anonymoushttps://www.blogger.com/profile/05265343573323745994noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-80482056602750048852016-07-08T23:17:35.635-04:002016-07-08T23:17:35.635-04:00Otangelo,
"no idea. LOL."
We already k...Otangelo,<br /><br />"no idea. LOL."<br /><br />We already know that, you have demonstrated it over and over again.<br /><br />You are being asked to provide a positive quantitative argument in favor of your baseless claims. Something ID/creationists have never been able to do.Chris Bhttps://www.blogger.com/profile/04778164246719803780noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-69697324797814385702016-07-08T17:27:00.604-04:002016-07-08T17:27:00.604-04:00no idea. LOL.
does it instruct for something spe...no idea. LOL. <br /><br />does it instruct for something specific ? Anonymoushttps://www.blogger.com/profile/05265343573323745994noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-3974233334745151632016-07-08T15:58:44.895-04:002016-07-08T15:58:44.895-04:00Elshamah, why did you change the subject?
How mu...Elshamah, why did you change the subject? <br /><br />How much CSI is there in this intelligently designed DNA sequence?:<br /><br />AAAGGGCCCTTTAAGGCCTTAGCT <br /><br />Compute it for me and Show your work (as the math teacher would say). Mikkel Rumraket Rasmussenhttps://www.blogger.com/profile/07670550711237457368noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-11550913933825385382016-07-08T14:38:34.906-04:002016-07-08T14:38:34.906-04:00Not ElShamah777 again. "I don't believe ...Not ElShamah777 again. "I don't believe chemistry, random changes, plus selection are enough" at great length. Sigh.Anonymousnoreply@blogger.comtag:blogger.com,1999:blog-37148773.post-89897765839073275592016-07-08T14:27:37.171-04:002016-07-08T14:27:37.171-04:00This comment has been removed by a blog administrator.ElShamah777https://www.blogger.com/profile/12608626398803379702noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-79681957146450144292016-07-08T14:26:04.234-04:002016-07-08T14:26:04.234-04:00This comment has been removed by a blog administrator.ElShamah777https://www.blogger.com/profile/12608626398803379702noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-42192643687142133782016-07-08T14:25:29.349-04:002016-07-08T14:25:29.349-04:00This comment has been removed by a blog administrator.ElShamah777https://www.blogger.com/profile/12608626398803379702noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-85236653084868603772016-07-08T11:43:31.299-04:002016-07-08T11:43:31.299-04:00How much CSI is there in this intelligently design...How much CSI is there in this intelligently designed DNA sequence?:<br /><br />AAAGGGCCCTTTAAGGCCTTAGCT <br /><br />Compute it for me and <b>Show your work</b> (as the math teacher would say). <br /><br />Mikkel Rumraket Rasmussenhttps://www.blogger.com/profile/07670550711237457368noreply@blogger.comtag:blogger.com,1999:blog-37148773.post-73731384773877813122016-07-08T10:43:53.596-04:002016-07-08T10:43:53.596-04:00This comment has been removed by a blog administrator.ElShamah777https://www.blogger.com/profile/12608626398803379702noreply@blogger.com