More Recent Comments

Sunday, October 02, 2016

Extending evolutionary theory? - Denis Noble

I will be attending the Royal Society Meeting on New trends in evolutionary biology: biological, philosophical and social science perspectives. I'll post each of the abstracts and ask for your help in deciding what question to pose to the speakers. Here's the abstract for Denis Noble's talk on Evolution viewed from medicine and physiology.

Medicine and physiology are multi-level disciplines. So is physics. From physics we learn that ordered properties at high levels co-exist with randomness at lower levels. Molecules in organisms must obey the same principles. Stochasticity at low levels does not therefore exclude order at higher levels. Organisms enlist stochasticity in their development of functional behaviour, through restraints exerted by higher over lower levels. The physics of organisms must therefore interact with their genomes to produce the phenotype1,2. Reverse engineering from physiological models is then required to understand genotype-phenotype relations3. There is no privileged level of causality4, nor privileged level of selection5. Evolution involves interaction between several processes at multiple levels, as Charles Darwin also believed5,6. Without understanding these interactions, gene-centred approaches will continue to produce disappointing results in healthcare7,8, including trans-generational disease risks.
I have heard Denis Noble speak and I've read some of his papers [Physiologists fall for the Third Way; A physiologist thinks about evolution]. Denis Noble is a physiologist who worked on hearts and circulation in complex mammals (humans). He's very annoyed at biochemists and molecular biologists for getting so much attention (and money) over the past few decades. He has constructed in his mind a false image of evolution. He thinks it's entirely adaptationist and gene-centric and that's what he rails against. He doesn't like Richard Dawkins. He's a prominent member of The Third Way.

You can see for yourself by watching a video of a talk he gave a few years ago.


I agree completely with Jerry Coyne's analysis of this talk [Famous physiologist embarrasses himself by claiming that the modern theory of evolution is in tatters]. Jerry says ....
I’m writing this post in a bit of anger, as Noble’s attacks on the modern synthesis are both poorly informed and clearly motivated by his ambition to make physiology a central part of evolutionary biology. Although he’s an FRS and famous, he wants more: he wants his field to be central to evolution. But such misguided hubris is not the way science is supposed to be done. And physiology is already important in evolutionary biology. It’s the reason why we look at the effects of a gene substitution, for example, not as a simple one-gene-produces-one-trait issue, but as a the gene’s overall effect on reproductive output through its effects ramifying through the complexities of development. Noble says that evolutionists are guilty of this “one-gene-one-trait” error, but he’s just wrong: I don’t know a single person in my field who holds this simplistic view.

None of the arguments that Noble makes are new: they’re virtual tropes among those people, like James Shapiro and Lynn Margulis, who embarked, at the end of their careers, on a misguided crusade to topple the modern theory of evolution.

However famous Noble may be in physiology, he’s a blundering tyro when it comes to evolutionary biology. He might try discussing his ideas with other evolutionists and listening to their responses. He obviously hasn’t done that, and yet travels the world trading on his expertise in physiology to show that the edifice of modern evolutionary biology is rotten. And he writes papers to that effect, including the dreadful piece referenced below.

But what’s really rotten is Noble’s knowledge of the field and his claim that virtually every assumption of neo-Darwinian evolution is wrong. In fact, his arguments are so rotten that they stink like old herring.

They’re not even wrong.
I'm not going to ask any questions after this talk. I'll report back on how many people seem to agree with him.


148 comments :

Anonymous said...

Give him a fair hearing! He's not as crazy as you suggest.

Jmac said...
This comment has been removed by a blog administrator.
Larry Moran said...

what are you going to do now?

I going to delete all your comments because you are such a jerk.

Robert Byers said...

Well Jerry Coyne is right to say physiology is not evolutionary biology. Yet also biology is not evolutionary biology. Finally the atom is split.
Acquired characters CAN BE absorbed?
Thats different.
A creationist must believe these things to explain just plain human colours. We can't have them evolve. They were needed and right away and God would not allow people to die because of not having a colour for dealing with the environment.
Anyways he does see evolutionism as needing revision.
There is to him, and his audiences somewhat, a problem in explanation from old time evolution.
If he, and others, are not persuaded but still evolutionists then the public having such doubt/disbelief is more easily understood.



Joe Felsenstein said...

(This is not a response to Byers's comment above).

Larry said of Noble: He's very annoyed at biochemists and molecular biologists for getting so much attention (and money) over the past few decades.

That reminds me of a story from my time as a graduate student in the 1960s. Our department chairman was a nice old guy who was a physiologist. Another grad student came across him talking to an old crony of his while the department chair was busy using some equipment in a lab. The department chair's friend was overheard to say "Don't you think this DNA business is going to blow over?"

Eric said...

The pervasive and troubling trend among the EES crowd is to misrepresent the theory of evolution. They create a strawman version of evolution, then take turns burning it in effigy. The "one gene" strawman is seen here. Elsewhere, there is the "all non-coding DNA was considered junk" strawman being hoisted onto the gallows. If nothing else, it would be helpful to call them on these misrepresentations.

Arlin said...

Much heat, no light. Neither of them understands the theory of evolution formerly known as the Modern Synthesis, nor the significance of the "mutation is random" claim.

The CRISPR-Cas system *is* designed to produce mutations that are advantageous, contrary to Coyne's assertion. The mutations are actually informed by conditions that are internalized and incorporated into the genome, in the form of bits of phage DNA.

The significance of that depends on what this "random mutation" claim was supposed to mean. What? Was it supposed to mean that Coyne, et al had deduced from the laws of nature that CRISPR-Cas is physically impossible? Did it mean that Coyne, et al had examined mutation in quantitative detail and discovered that CRISPR-Cas systems, however possible, were in fact vanishingly rare? Either way, they would be wrong. Such systems are common in prokaryotes. I suppose that, in most alternative universes, the Luria-Delbruck experiment -- which involved resistance to a phage-- comes out the other way.

But that isn't even what "mutation is random" means. The claim pre-dated any detailed knowledge of mutation. In fact, it isn't really a claim about mutation per se. The randomness claim is not made by mutation experts, but by evolutionists who haven't spent a single month of their lives studying the biology of mutation, and who know next to nothing about the topic. What they really mean to say is that mutation is irrelevant to anything that matters.

Because evolutionary biologists themselves equate "the Modern Synthesis" with "whatever we think", which is constantly updated, the "Modern Synthesis" is sometimes criticized for things that are not even part of evolutionary theory. Noble has written entire papers critiquing forms of genetic reductionism that have absolutely nothing to do with the theory put forward by Mayr, Dobzhansky, Simpson, et al in the mid-20th-century. That theory claimed that evolutionary change is *always* polygenic, complex, and driven by environmental change: conditions change, and then "selection" shifts the frequencies of alleles (each with infinitesimal effects) present in abundance in the "gene pool"-- shifting from the old adaptive optimum to a new multi-locus adaptive optimum determined by the environment. That is the Modern Synthesis theory of evolutionary genetics. This was not a reductionist theory at all.

However, it is quite different from the view of evolutionary dynamics accepted today by evolutionary geneticists.

Jmac said...
This comment has been removed by a blog administrator.
Eric said...

"Well Larry, you can start by explaining why you are so afraid of change."

Both Larry and I are against people misrepresenting science. I don't see how Larry is against change.

Can you process that?

Eric said...

The randomness of mutations goes back to Luria, Delbruck, and the Lederbergs. In each of those experiments, random refers to fitness. For example, mutations conferring antibiotic resistance in the Lederbergs' plate replica experiment occurred on plates that had no antibiotic. Those mutations weren't needed at the time, and they didn't increase fitness, yet there they were.

The question at the time was whether these types of mutations occurred in response to challenge or if they were just appearing in the background whether the organism needed them or not. Those experiments found that mutations were random WITH RESPECT TO FITNESS.

As to the CRISPER-Cas systems, they only affect a small number of genes and they have little explanatory power when it comes to the differences between divergent species. What gets lost in these EES discussions, IMHO, is what we are trying to explain to begin with. What we are trying to explain is why species look different from one another. Can epigenetics cause fat mice to give birth to fat mice? It would appear so. Does that mechanism explain why mice look different from cats? No, it doesn't. The reason cats look different from mice is because of DNA sequence differences, not epigenetics.

EES is trying to make a mountain out of a mole hill by trying to convince people there is no mountain.

ElShamah777 said...

Eric wrote:

"Both Larry and I are against people misrepresenting science."

What you probably mean is : " "Both Larry and I are against people interpreting the scientific evidence in order to refute naturalism."

That is a common misconception of proponents of naturalism/atheists. They conflate science with naturalism.
They think they have a free lunch because modern science is based on methodological naturalism, that science equals naturalism.

Fact is, there is no dispute in regard of the scientific evidence " per se". What we dispute is, how to explain the origins of the phenomenas we observe in nature.

Here at this place, it is more than evident that there is by most a strong rejection towards everything that is interpreted as ID. Otherwise, the rare proponents that show up here, would not be called IDiots, and Larry be the first one giving a nice example of how to do it.... sad, sad.....

Arlin said...

you lost me there, Eric. What is the basis of your assertion that "As to the CRISPER-Cas systems, they only affect a small number of genes and they have little explanatory power when it comes to the differences between divergent species."? This sounds like mere assertion, devoid of reason or evidence.

Eric said...

In prokaryotes, the CRISPR-Cas system is limited to inserting viral (i.e. bacteriophage) DNA into CRISPR loci. This system is not a freewheeling mechanism by which any base can be changed in response to a specific stimuli. On top of that, this is only found in some prokaryotes. Obviously, it can't explain any changes in eukaryotes.

The real assertion is that the CRISPR-Cas system is important in understanding the overall divergence of species.

Arlin said...

This supports my interpretation of the "mutation is random" claim as an explanatory claim about what is "important", the purpose of which is to subordinate the role of mutation to that of selection. Darwin's followers believe that selection explains what is important, and mutation merely supplies raw materials. I was just reading a contemporary paper with a very quotable statement in this regard: "Natural selection has shaped all the beautiful and extraordinary diverse phenotypes of living organisms,(1) while random mutations provide the raw material for this process.(2)" The first citation is to Darwin, and the second is to Luria and Delbruck, neither of which documents the claim that variation merely provides raw material.

Arlin said...

sorry, forgot to provide citation: Philippe, et al, 2007, "Evolution of global regulatory networks during a long-term experiment with Escherichia coli" http://dx.doi.org/10.1002/bies.20629

BTW, the article itself also fails to support the raw materials doctrine.

Arlin said...

See also the left side-bar, which has a quotation from Gould on "The essence of Darwinism"

Eric said...

What is important is explaining why species look different from each other, both at the genome and organismal level. CRISPR has nothing to do with why species look different from each other at the organismal level. CRISPR can explain why specific regions of the bacterial genome are different from each other, but these are very limited regions. Overall, CRISPR has very little to do with why species are different from each other. However, random mutations and selection do have a very large impact on why species are different from each other, both morphologically and genetically.

Also, Luria, Delbruck, and the Lederbergs DID show how mutations provide the raw material for selection. Perhaps you should read up on the plate replica experiment and the fluctuation test. They showed that the process of mutagenesis is blind to the needs of the organism.

Eric said...

"What you probably mean is : " "Both Larry and I are against people interpreting the scientific evidence in order to refute naturalism.""

When you are done putting words in my mouth, please respond to what I actually said.

Also, methodological naturalism is the scientific method. Science is the scientific method. It isn't the fault of science that your religious beliefs are not scientific.

Jmac said...
This comment has been removed by a blog administrator.
ElShamah777 said...

Eric

in that case,you need to back up your claim.

Bill Cole said...

Eric
"Also, methodological naturalism is the scientific method. Science is the scientific method."

Can you show me how the TOE uses the scientific method to validate its claims?

Mikkel Rumraket Rasmussen said...

Evolutionary theory is not a person, it can't "do" or "use" anything. Rather, it is people who use the scientific method to validate evolutionary theory.

They do this by performing experiments and doing field observations to test the predictions of theory.

Faizal Ali said...

Can you show me how the TOE uses the scientific method to validate its claims?

Here you go, Bill. Demonstrate that every single one of these 4.8. million papers fail to use the scientific method. There's a good boy.

https://scholar.google.ca/scholar?hl=en&q=evolution&btnG=&as_sdt=1%2C5&as_sdtp=

Arlin said...

Eric, permit me to suggest that you are missing the point here because you are badly underestimating my knowledge and understanding of the topic. Of course, you don't actually know that "CRISPR has very little to do with why species are different from each other". This would require a major research project, or perhaps even a career. But it accurately represents the Darwinian faith that mutation can't be responsible for anything interesting or important.

A more convenient source of information on the fluctuation experiments is the review by Sarkar 1991 in Tauber, _Organism and the Origins of Self_.

Perhaps the "raw materials", like "Modern Synthesis", is now a wishy-washy term with the same kind of Humpty-Dumptian "whatever we say it means" definition. However, when this metaphor was invoked by the architects of the Modern Synthesis, it actually meant something. It meant that the role of variation in evolution was like that of the raw materials in a process of manufacturing. Raw materials are used in bulk. They provide material or substance only, not form. This is how the Modern Synthesis viewed the role of variation.

In the Luria-Delbruck experiment, a single mutation is responsible for the resistance phenotype. This is quite the opposite of what was meant by a raw material. This was a case of de Vriesian "lucky mutant" evolution, entirely contrary to the actual historic Modern Synthesis.

John Harshman said...

Bill, do you recall that paper on paleognath phylogeny you got from me? It's an example of how scientists use the scientific method to validate some evolutionary claims.

Faizal Ali said...

No, John. Your paper assumed that common descent exists, it didn't demonstrate it. Oh, and your study also showed that ratites are polyphyletic, which means they are less likely to share common ancestry. I mean, what else can "polyphyletic" mean?

Your problem is that you didn't have your paper peer-reviewed by an expert like Bill Cole. Or Robert Byers.

judmarc said...

Arlin -

Are there examples of non-random mutation you can give that don't involve challenges from infectious organisms?

Eric said...

" Of course, you don't actually know that "CRISPR has very little to do with why species are different from each other"."

You really need to read up on the CRISPR system. It takes viral DNA and inserts into specific CRISPR domains. That's it. Also, it only exists in archae and prokaryotes, not in eukaryotes. None of the genetic differences between any two vertebrate species is due to CRISPR activity.

Also, we don't need faith. We have evidence that random mutations are responsible for the differences between species. First, we can watch them occur in real time. Second, we can show differences in divergence rates between genes and pseudogenes in the form of Ka/Ks ratios. Third, we have the observation of a nested hierarchy, exactly what we should see if random mutations are responsible for divergence between species. No faith involved.

Now you are making claims about the history of the Modern Synthesis. Why don't you actually back it up with some references?

Bill Cole said...

John
" John
"Bill, do you recall that paper on paleognath phylogeny you got from me? It's an example of how scientists use the scientific method to validate some evolutionary claims."

What claim did your 2008 paper support?

judmarc said...

Bill, my apologies for diverging from the subject of biological evolution, but I wanted to ask about a topic I think is related.

Don't know if you've ever looked at Chaucer in the original middle English. (See for example http://www.librarius.com/cantales.htm .) I assume you've read Shakespeare. In thinking about how English has evolved in the 600 years since Chaucer and the 400 years since Shakespeare, do you account for this primarily by direction from a guiding entity, or through selection from among random variations? Extending this back, please consider the same question with regard to the divergence of English, French, German, etc., from older European languages. What do you think?

Faizal Ali said...

Prediction: Bill tries to evade the question by saying that languages are the product of intelligent beings.

Arlin said...

OK, I warned you that you are in over your head. I would be happy to document for you how that the lucky mutant view is not the same as the Modern Synthesis. Below is a section from "Mutation, Randomness, and Evolution", a book that I'm writing. The title of this short section is "When 'Darwinian adaptation' is neither".

Today, a process involving the fixation of new mutations with beneficial effects is universally called ”adaptation” or ”Darwinian adaptation” (e.g., Orr, 2005b; Weinreich et al., 2006; Jain and Seetharaman, 2011). Yet, previous generations of evolutionary biologists would have objected. Classically, ”adaptation” refers to a stimulus-response dynamic: conditions change, then a biotic system adjusts in a graduated manner, depending on the strength and duration of the stimulus, representing either short-term (physiological) or long-term (evolutionary) adaptation.

Colloquial usage has the same connotation: when we admire someone’s adaptability, we mean to draw attention to how they respond appropriately to new or changing conditions, not to how they suddenly have great new ideas, or how they continually improve in a constant environment.

Our intellectual progenitors used a different term for the lucky mutant view. For instance, Shull (1936) states, in regard to mutation-initiated evolution, ”the whole process as Goldschmidt conceives it is one that was sponsored by Cu ́enot and Davenport and by the former called preadaptation. First a change occurred, fitting individuals for a new situation, and then sometimes the new situation was either near at hand or was accidentally reached” (p. 254; Charles Davenport and Lucien Cu ́enot were early geneticists known for their evolutionary views). When Cavalli-Sforza and Lederberg (1956) set out to show that mutations conferring antibiotic resistance are spontaneous in the Luria-Delbruck sense (see section 2.9), occurring prior to the onset of selective conditions, their paper was entitled ”Isolation of Pre-Adaptive Mutants in Bacteria by Sib Selection,” and the paper referred to the preadaptation theory.

Likewise, the architects of the Modern Synthesis used ”pre-adaptation” or ”random pre-adaptation” to distinguish the lucky mutant view from genuine adaptation (e.g., Simpson, 1967, p. 157, 236, 257, Mayr, 1963, p. 121). Dobzhansky 1974, p. 325, gives DDT resistance in insects as an example of ”preadaptation”, arguing that resistant flies must have been present in the population prior to exposure. Referring to the early geneticists, Simpson (1967) complained that ”the problem of adaptation was, in their opinion, solved by abolishing it: they proclaimed that there is no adaptation, only random pre-adaptation” (p. 276).

(continued...I have to split this to avoid the size limits)

Arlin said...

(concluding)
Darwin would have agreed. Ever since he proposed ”natural selection” based on indefinite variability and blending, impatient readers have misconstrued it as a Mendelian theory of pre-adaptation based on discrete inheritance. Because this misinterpretation happened in Darwin’s time, no speculation is required to know his response. When challenged that his theory was ”not a theory of the Origin of Species at all, but only a theory on the causes which lead to the relative success and failure of such new forms as may be born into the world,” Darwin’s response was ”that may be a very good theory, but it is not mine” (Poulton, 1909, p. 45). This is why Morgan said that ”Modern zoologists who claim that the Darwinian theory is suciently broad to include the idea of the survival of definite [i.e., discrete] variations seem inclined to forget that Darwin examined this possibility and rejected it” (Morgan, 1904, p. 60).

That is, not only did the architects of the Modern Synthesis have a different term for the adventitious fixation of beneficial mutations, they downplayed the importance of this process, which was not associated with their neo-Darwinian view, but with the views of early Mendelians. This important difference is obscured by a change in the meaning of the term ”adaptation”. Here I have bowed to contemporary usage only because a return to the historic meaning of "adaptation" would be jarring for readers accustomed to the degraded meaning of the term. However, the lucky mutant models referred to as ”Darwinian adaptation” are actually models of de Vriesian aptation, fitting more comfortably with the thinking of de Vries or Morgan than of Darwin. (end)

John Harshman said...

Bill, why do you ask pointless questions?

The paper supported a number of claims: that paleognaths are all descended from a common ancestor, that paleognaths other than ostriches are descended from a somewhat more recent ancestor, that flightlessness evolved several times, that the living Australasian ratites have an even more recent common ancestor, that divergence is not a result of simple vicariance related to plate tectonics, that tinamous have an anomalously high rate of molecular evolution across the genome. Didn't you get any of that out of reading the paper?

Arlin said...

judmarc, this question is problematic because of the slipperyness of the Darwinian position on "random". If you bring up an example of mutation that is non-random in the sense of being non-uniform, or in the sense of being non-spontaneous-- and there are endless examples-- they will just claim that this is not what they mean by "randomness".

If you bring up an example like CRISPR-Cas, where the bacteria are responding to the presence of a phage by generating situation-appropriate (phage-specific) mutations, then like Eric above, they will appear to switch the topic and argue that this system isn't *important* because it isn't *influential*. CRISPR-Cas isn't the only example. Yeast mating-type switching is a regulated, directional mutation that switches the mating type of spores in a situation-appropriate manner. In diploids, the rate of this kind of mutation is about 1 in a million per generation, but haploid spores upon germination undergo a bud-and-switch then bud-and-don't-switch alternating cycle that tends to ensure even numbers of both mating types in close proximity. The switching is almost deterministic.

But the Darwinians are slippery. They have such a complacent sense of empowerment, and so little rigor, that if an example has been around for decades, like the yeast example, they will assume that it must be consistent with the randomness doctrine, because of course someone in authority would have told them if it weren't (it's really a powerful faith in orthodoxy to believe that facts apparently contrary to your beliefs can't actually be contrary to your beliefs, because the all-knowing arbiters of wisdom would have noticed any contradictions already). We first need to get Darwin's followers to indicate what kind of physically possible examples would contradict their faith that selection shapes the world and mutation is merely a source of random raw materials.

If not, then the Darwinian position is not falsifiable and there is no point in bringing up examples.

Unknown said...

Arlin,

I'm genuinely confused as to what you are claiming. Are you saying that mutations are non-random, in the sense used by evolutionary biologists (ie with respect to fitness)? If so, that is an extraordinary claim. And as they say, extraordinary claims require extraordinary evidence.

ps: Eric is right about CRISPR. It's a really cool example of 'adaptive immunity'. But it's explainable in terms of conventional evolutionary theory.

Eric said...

"judmarc, this question is problematic because of the slipperyness of the Darwinian position on "random". "

The definition has been the same since the 50's when it was defined by Luria, Delbruck, and the Lederbergs. It has been defined as being random with respect to fitness which means that the processes which produce mutations are blind to which mutations the organism needs in a given environment.

Eric said...

If a mechanism only explains less than 0.1% OF the genetic differences between species (or 0% in the case of eukaryotes), wouldn't you say that it isn't as important as the other 99.9%? Not that hard to figure out. The facts are that the vast, vast majority of genetic and morphological differences between species is due to random mutations and natural selection, not changes caused by CRISPR-Cas.

If importance isn't based on the amount of influence a mechanism has on a system, then what should we base importance on? Your whims that morning? Alphabetical?

Eric said...

"Today, a process involving the fixation of new mutations with beneficial effects is universally called ”adaptation” or ”Darwinian adaptation” (e.g., Orr, 2005b; Weinreich et al., 2006; Jain and Seetharaman, 2011). Yet, previous generations of evolutionary biologists would have objected. Classically, ”adaptation” refers to a stimulus-response dynamic: conditions change, then a biotic system adjusts in a graduated manner, depending on the strength and duration of the stimulus, representing either short-term (physiological) or long-term (evolutionary) adaptation. "

You have conflated terms. Adaptation in the Modern Syntehsis is not the same as phenotype or behavioral adaptability. Your entire thesis is tainted by that conflation.

As to mutations, the randomness of mutations has been a settled issue since Luria, Delbruck, and the Lederbergs. Non-random and random mutations were all possibilities during the formation of the Modern Synthesis, but subsequent experiments demonstrated that mutations are random with respect to fitness. It is the EXPERIMENTS that settled the issue, and the data collected since then has consistently supported that conclusion.

Ernst Mayr said it best:

"By the end of the 1940s the work of the evolutionists was considered to be largely completed, as indicated by the robustness of the Evolutionary Synthesis. But in the ensuing decades, all sorts of things happened that might have had a major impact on the Darwinian paradigm. First came Avery's demonstration that nucleic acids and not proteins are the genetic material. Then in 1953, the discovery of the double helix by Watson and Crick increased the analytical capacity of the geneticists by at least an order of magnitude. Unexpectedly, however, none of these molecular findings necessitated a revision of the Darwinian paradigm—nor did the even more drastic genomic revolution that has permitted the analysis of genes down to the last base pair."
--Ernst Mayr, "80 Years of Watching the Evolutionary Scenery"

Dr. Mayr was around for the entire thing. He helped form the Modern Synthesis, and was still active in the 2000's. He clearly states that nothing we have discovered about genetics has changed the Modern Syntehsis, and that includes the randomness of mutations.

What you also keep forgetting is that we use the Modern Synthesis, also called neo-Darwnism. We don't use Darwinian evolution. That was left behind a long time ago. The EES people are speaking about the Modern Synthesis, not the theory that Darwin first constructed 150 years ago.

christine janis said...

@Arlin: " Below is a section from "Mutation, Randomness, and Evolution", a book that I'm writing."

That's all very well and good ---- but do you have a publisher?

Arlin said...

On the contrary, Eric, it is not at all clear what evolutionary biologists mean by the randomness doctrine, e.g., your definition, like many others, invokes animistic "needs" or demands of the environment and must be discarded on this basis. The confusion is so persistent that multiple philosophers have waded into this with the explicit aim of sorting out what evolutionary biologists really mean to say. The most recent example would be Razeto-Barry and Vecchi, 2015. This was preceded by Merlin, 2010, and even earlier by John Beatty and by Roberta Millstein.

Arlin said...

Kathleen, CRISPR *is* exactly the kind of system that Darwinists have been saying all along was impossible. It produces situation-appropriate mutations that provide specific immunity. Challenge it with phage A, and you get mutations that provide immunity to phage A. Challenge it with phage B, and you get mutations that provide immunity to phage B. Challenge it with phage C, and you get mutations that provide immunity to phage C. The Luria-Delbruck experiment would have failed if they had just used one of these systems. Claiming that this is nothing new is positively Trumpian.

Arlin said...

I'm just trying to understand two things about your faith system. The first is what causes you to bail out on defending the randomness doctrine and retreat to the issue of "importance".

The second is what leads you to make these statements about numeric proportions without any systematic knowledge. The extent to which propensities of mutation shape the outcome of evolution is an unanswered question in science-- at least, for rigorous thinkers who stick close to the evidence. Many people in molecular evolution would say that the outcome of evolution is strongly shaped by biases in mutation. But you seem to have arrived at a *quantitative* answer, without citing any systematic evidence.

Eric said...

"I'm just trying to understand two things about your faith system."

It is a scientific theory backed by evidence, not faith. In fact, I already gave you that evidence which you continue to ignore. Perhaps you could address it?

"But you seem to have arrived at a *quantitative* answer, without citing any systematic evidence."

The math is pretty simple for eukaryotes. 0% of genetic differences between eukaryotic species is due to CRISPR-Cas because eukaryotes don't have these DNA features or proteins.

For archae and bacteria we can do the math. Archae can have up to about 18 CRISPR units that are about 350 base pair each. By my math, that is about 6,000 base pairs. The average prokaryotic genome is about 3 million base pairs, so that comes to about 0.2% of the genome affected by CRISPR.

http://www.asm.org/ccLibraryFiles/FILENAME/000000004866/znw00509000224.pdf

Do you have some different math?

Arlin said...

Eric, I'm sorry this is so confusing for you. The original Modern Synthesis is defined in the works of Mayr, Dobzhansky, Simpson, and so on. These are the people that I quoted. The concept that they called "random pre-adaptation" and associated with the mutationists, is the concept that Orr, Weinreich, et al. now call "Darwinian adaptation".

I know that defenders of neo-Darwinism are in such a difficult position that they keep falling back on the argument that the "Modern Synthesis" can change positions. They muddy the waters by confusing a scientific theory with a research program or a school of thought. Perhaps a bit of shifting could be allowed even for a genuine theory. However, if the "Modern Synthesis" "evolves" so that it now includes mutationism, then continuing to call it the "Modern Synthesis" would be an act of deception.

Arlin said...

Eric, I think we might have to go back to Sci 101 to talk about what the word "evidence" means in science. Making a calculation is a sign that you are willing to use reason, which is great, but that is not the same thing as evidence.

You said earlier that "What is important is explaining why species look different from each other". You have made a calculation about expected genomic fractions of different kinds of mutations. This doesn't exhaust the issue. It is just one simple calculation. It could be that 20 % of the changes that keep a lineage from dying out are occurring in that 0.2 % of the genome. It could be that the biosphere would look completely different today if it weren't for CRISPR-Cas evolving a billion years ago (or whenever it evolved).

As I said previously, it would take a research project, or perhaps a career, to explore this question more fully. You seem to have decided the issue in a matter of minutes.

Arlin said...

That hardly matters. I only mention that I'm writing a book because it might decrease the chance of people wasting my time by responding to my comments by reciting textbook wisdom or quoting hacks like Ernst Mayr. Obviously that isn't working.

Eric said...

We already know that CRISPR units have nothing to do with the morphology of a bacterium. The research has already been done. They aren't involved in metabolism, cell wall construction, flagellar construction, septum formation, or any other classic example of bacterial typology. CRISPR is limited to expressing short pieces of RNA from viral sources that is used to tag viral DNA and degrade it. That's the limit of the system.

These regions of palindromic CRISPR DNA make up a small portion of the genome. The rest of the genome changes through random mutagenesis, and is responsible for vast majority of structural and metabolic proteins that contribute to the function and morphology of the bacterium.

The point is that the research is already in. It has been done.

Eric said...

Doesn't change the fact that the other 99% of the bacterial genome evolves through random mutations and natural selection. Finding small exceptions does not make the general rule go away.

Arlin said...

QED, the neo-Darwinian position isn't falsifiable. If what was alleged to be a universal principle is violated, you just claim that this is an exception. No error is admitted. Perfect Trump. Not science.

Arlin said...

Thanks, Eric. I think its great that you are a true believer, a true follower of Darwin, and you are willing to assert that variational effects can't possibly be important in evolution, without having done any research on the topic, merely based on the confidence that the neo-Darwinian view must be correct because, well, it just has to be. Please, keep doing this. Please keep proclaiming loudly that "we already know" things that we don't, in fact, already know. I applaud you. You are making my case for me. If only you could make a concrete falsifiable statement, rather than just asserting that everything is grand, that would be even better.

The whole truth said...

Arlin, will you please show where Eric asserts that "variational effects can't possibly be important in evolution"?

judmarc said...

My understanding of Arlin's statement is that he was referring to Eric's assertion that CRISPR-Cas is relatively unimportant (based at least in part on his calculation), while I believe Arlin is asking whether non-random mutations that confer a degree of immunity from phage activity can truly be assessed as unimportant to the survival of the bacterial lineages that have this ability.

judmarc said...

Rather than "non-random," let me try to be a little more precise lest a potentially interesting conversation go off the rails.

Arlin, I don't believe you are trying to say there is a directing intelligence behind the CRISPR-Cas example, or any future-directed activity (that is, a response not directed toward the immediate environmental challenge).

As a layperson I'm unfamiliar with the yeast example. Can this also be characterized as a response to immediate environmental conditions (though from your description one that responds to those conditions by activity with beneficial consequences for future generations)?

Eric said...

"Thanks, Eric. I think its great that you are a true believer, a true follower of Darwin, and you are willing to assert that variational effects can't possibly be important in evolution, without having done any research on the topic, merely based on the confidence that the neo-Darwinian view must be correct because, well, it just has to be."

Nowhere do I claim that "variational effects" are unimportant. In fact, I have stated over and over that random mutations are very important. What I have also stated over and over is that the CRISPR system only accounts for a tiny percentage of all "variational effects" which is why it is of less importance.

I also demonstrated that we do know what CRISPR does, and that CRISPR specific activity makes up a tiny percentage of the overall change in prokaryotes. It is also known that CRISPR doesn't even exist in eukaryotes. It is you who is ignoring the evidence and ignoring the research.

Anonymous said...

@Arlin
First of all, I enjoyed your ‘curious disconnect series’ presented here on this blog (I learned a lot). In addition I like your ideas about constructive neutral evolution. But I'm a bit puzzled by the discussion you have with (mainly) Eric.
To understand you position better I would like to ask some questions:

1) What is your interpretation of the fluctuation test as done by Luria & Delbrück? Doesn’t it show that ‘conventional’ mutations are (keeping in mind that different regions of the genome have different frequencies for being hit by a mutation), as Eric stated, blind to their effect? Why do you disagree?

2) You say the position of Mayr & Co is: “That theory claimed that evolutionary change is *always* polygenic, complex, and driven by environmental change: conditions change, and then "selection" shifts the frequencies of alleles (each with infinitesimal effects) present in abundance in the "gene pool"-- shifting from the old adaptive optimum to a new multi-locus adaptive optimum determined by the environment.”. This is my understanding of Mayr & Co as well, but what besides the ‘always’, the infinitesimal (which I consider to be an abstraction) and the incompleteness is wrong about it?
By the way Mayrs writing about the ‘founder effect’ implies that he must have been aware of the fact that there is not always an ample supply of alleles available for evolution to work with.

3) I agree with you (like Eric, I presume) that CRISPR-Cas produces situation-appropriate mutations and that a ‘fluctuation test in the “CRISPR-Cas-setting” suggested by you would produce a different result, compared to the Luria/Delbrück setting. It looks like that Mayr & Co overlooked something (possibly a lot). But so what? We live in the 21st Century.

4) I agree that the outcome of evolution is shaped by biases in mutation (it has to be that way to a certain extent, doesn’t it?). I would consider this (in my amateurish thinking) to be some kind of constraint (‘positive or negative’) for evolution, which certainly should effect its possible direction. My feeling (maybe I’m wrong) is that most scientists would nowadays agree. But how does this invalidate Erics interpretation of the fluctuation test (Luria/Delbrück version)?

5) Calling Mayr a hack is in my opinion overblown and not nice, to say the least. He was vocal and possibly often wrong. But aren’t we all? (I believe that this is a rhetorical question, why don’t you?)

Thanks,
Michael

P.S.
I believe it is nonsense to compare the importance of mutations and selection for evolution against each other. Both are part of the game. It is a non-discussion.

Unknown said...
This comment has been removed by the author.
Anonymous said...

Dear brave Unknown,
please give a list of YOUR papers on the wider topic.
I have none on Evolution.
Below find a selection of Arlins.
Cheers,
Michael Leichter

1: Stoltzfus A, Norris RW. On the Causes of Evolutionary Transition:Transversion
Bias. Mol Biol Evol. 2016 Mar;33(3):595-602. doi: 10.1093/molbev/msv274. Epub
2015 Nov 25. PubMed PMID: 26609078.


2: Stoltzfus A, McCandlish DM. Mutation-biased adaptation in Andean house wrens.
Proc Natl Acad Sci U S A. 2015 Nov 10;112(45):13753-4. doi:
10.1073/pnas.1518490112. Epub 2015 Oct 21. PubMed PMID: 26489650; PubMed Central
PMCID: PMC4653193.


3: McCandlish DM, Stoltzfus A. Modeling evolution using the probability of
fixation: history and implications. Q Rev Biol. 2014 Sep;89(3):225-52. Review.
PubMed PMID: 25195318.


4: Stoltzfus A, Cable K. Mendelian-mutationism: the forgotten evolutionary
synthesis. J Hist Biol. 2014 Winter;47(4):501-46. doi: 10.1007/s10739-014-9383-2.
PubMed PMID: 24811736.


5: Stoltzfus A, Lapp H, Matasci N, Deus H, Sidlauskas B, Zmasek CM, Vaidya G,
Pontelli E, Cranston K, Vos R, Webb CO, Harmon LJ, Pirrung M, O'Meara B, Pennell
MW, Mirarab S, Rosenberg MS, Balhoff JP, Bik HM, Heath TA, Midford PE, Brown JW,
McTavish EJ, Sukumaran J, Westneat M, Alfaro ME, Steele A, Jordan G. Phylotastic!
Making tree-of-life knowledge accessible, reusable and convenient. BMC
Bioinformatics. 2013 May 13;14:158. doi: 10.1186/1471-2105-14-158. PubMed PMID:
23668630; PubMed Central PMCID: PMC3669619.


6: Stoltzfus A, O'Meara B, Whitacre J, Mounce R, Gillespie EL, Kumar S, Rosauer
DF, Vos RA. Sharing and re-use of phylogenetic trees (and associated data) to
facilitate synthesis. BMC Res Notes. 2012 Oct 22;5:574. doi:
10.1186/1756-0500-5-574. PubMed PMID: 23088596; PubMed Central PMCID: PMC3583491.


7: Stoltzfus A. Constructive neutral evolution: exploring evolutionary theory's
curious disconnect. Biol Direct. 2012 Oct 13;7:35. doi: 10.1186/1745-6150-7-35.
Review. PubMed PMID: 23062217; PubMed Central PMCID: PMC3534586.


8: Yu G, Stoltzfus A. Population diversity of ORFan genes in Escherichia coli.
Genome Biol Evol. 2012;4(11):1176-87. doi: 10.1093/gbe/evs081. PubMed PMID:
23034216; PubMed Central PMCID: PMC3514957.


9: Vos RA, Balhoff JP, Caravas JA, Holder MT, Lapp H, Maddison WP, Midford PE,
Priyam A, Sukumaran J, Xia X, Stoltzfus A. NeXML: rich, extensible, and
verifiable representation of comparative data and metadata. Syst Biol. 2012
Jul;61(4):675-89. doi: 10.1093/sysbio/sys025. Epub 2012 Feb 22. PubMed PMID:
22357728; PubMed Central PMCID: PMC3376374.


10: Spiering MJ, Urban LA, Nuss DL, Gopalan V, Stoltzfus A, Eisenstein E. Gene
identification in black cohosh (Actaea racemosa L.): expressed sequence tag
profiling and genetic screening yields candidate genes for production of
bioactive secondary metabolites. Plant Cell Rep. 2011 Apr;30(4):613-29. doi:
10.1007/s00299-010-0979-5. Epub 2010 Dec 28. PubMed PMID: 21188383.


11: Prosdocimi F, Chisham B, Pontelli E, Thompson JD, Stoltzfus A. Initial
implementation of a comparative data analysis ontology. Evol Bioinform Online.
2009 Jul 3;5:47-66. PubMed PMID: 19812726; PubMed Central PMCID: PMC2747124.


12: Stoltzfus A, Yampolsky LY. Climbing mount probable: mutation as a cause of
nonrandomness in evolution. J Hered. 2009 Sep-Oct;100(5):637-47. doi:
10.1093/jhered/esp048. Epub 2009 Jul 22. Review. PubMed PMID: 19625453.


13: Stoltzfus A. Evidence for a predominant role of oxidative damage in germline
mutation in mammals. Mutat Res. 2008 Sep 26;644(1-2):71-3. doi:
10.1016/j.mrfmmm.2008.05.003. Epub 2008 May 25. PubMed PMID: 18597793.


14: Stoltzfus A, Yampolsky LY. Amino acid exchangeability and the adaptive code
hypothesis. J Mol Evol. 2007 Oct;65(4):456-62. Epub 2007 Sep 26. PubMed PMID:
17896070.

Anonymous said...

Dear Unknown,
deleting your comment is classy....

Bill Cole said...

John
" that paleognaths other than ostriches are descended from a somewhat more recent ancestor,"

This is what the molecular DNA data seemed to indicate.

Faizal Ali said...

Well, I'm sure John is very relieved to see you confirm his findings, Bill Cole.

Like, what the actual fuck?

John Harshman said...

Bill, I have to agree with lutesuite here. What the fuck are you trying to get at with your one-line evasions of the answers to your original question? That question, if you recall, was "Can you show me how the TOE uses the scientific method to validate its claims?" Can we agree that I have answered this question, after rephrasing it to put the agency on people rather than theories?

John Harshman said...

That seems like a gratuitous attack on a dead guy who can't respond. What did Ernst Mayr ever do to you?

(Not that he wasn't wrong on quite a few matters directly relating to my work, mind you.)

Unknown said...

Ah.. I see where you are coming from now. I am well aware that some people want to make a big thing about CRISPR being ‘Lamarckian’. Personally, I agree with Adam Weiss’ view that this claim is overblown(https://www.ncbi.nlm.nih.gov/pubmed/26411613).

The point I was trying to make is that if you look carefully, there is no reason to doubt that the whole elaborate CRISPR system was put together by known evolutionary mechanisms: Orgel's Second Rule and all that.

Bill Cole said...

John
Do you agree this is the scientific method?

Steps of the Scientific Method
Make an Observation. Scientists are naturally curious about the world.
...
Form a Question. After making an interesting observation, a scientific mind itches to find out more about it. ...

Form a Hypothesis. ...

Conduct an Experiment. ...

Analyse the Data and Draw a Conclusion.

In all the cancer research I have done all the papers follow this protocol typical with knock out experiments to test their hypothesis. How would you test the hypothesis that two species share a common ancestor? From what I see it is by morphological comparison and DNA comparison. How can you validate from this that they share a common ancestor? I believe you can infer it but that assumes that UCD is true.

If the assumption is that UCD is true I agree that your paper backs up the claims you made.

If you don't assume UCD is true then I think it only supports one of your claims which is that the ostrich shares a different ancestor than the other flightless birds.

If you are skeptical of the UCD claim I think your paper adds to the skepticism because of the claim of three losses of flight and the mixed DNA sequences of the ostrich.

I have found a 2014 paper that supports the claims you made in this paper and references you paper.

John Harshman said...

Do you agree this is the scientific method?

No. It's a scientific method, but there are other models of science. You are locked into some notion that laboratory experiments are the only science there is. But all lab experiments do is set up conditions under which gathering certain data is convenient. There are other ways to get data, and that includes data that came into being before any of us was born. After you get data, the methods of inference are quite similar. And it is indeed all inference — no distinction there.

Of course no inference about paleognaths needs to assume universal common ancestry, and even common ancestry of paleognaths isn't an assumption but an inference drawn from the data. I repeat: this is how all science works, and your distinctions are solely in your imagination. You have to ask yourself what alternative could conceivably explain the data as well, which you of course will not do.

There are no "mixed DNA sequences of the ostrich". I thought we had gone through that before. This too is your imagination. Now why should three losses of flight cause any skepticism?

Yes, there are quite a few papers that back up our conclusions. And not a one of them has to assume common descent a priori. Can't we consider them, in total, to be overwhelming evidence? There's your validation.

Faizal Ali said...

From what I see it is by morphological comparison and DNA comparison. How can you validate from this that they share a common ancestor?

So I guess you think courts should not accept DNA evidence in paternity cases. Correct?

judmarc said...

Morphological comparison; DNA comparison; geology (age of the fossils); I'm sure there's more. That's at least three independent branches of scientific inquiry that all cross-confirm each other, Bill.

I think your paper adds to the skepticism

Uh-huh.

Eric said...

@Bill Cole

" How would you test the hypothesis that two species share a common ancestor? From what I see it is by morphological comparison and DNA comparison. How can you validate from this that they share a common ancestor?"

UCD at both the morphological and genetic level is tested by measuring the phylogenetic signal. Scientists use statistical tests to see if shared derived characteristics fall into a nested hierarchy (i.e. a phylogeny). Not only that, but they test for a statistically significant match between phylogenies based on morphology and phylogenies based on genetics.

Talkorigins has a nice page on the convergence of independent phylogenies:

http://www.talkorigins.org/faqs/comdesc/section1.html#independent_convergence

We can also look at specific examples in specific lineages, such as the shared endogenous retroviruses found in the genome of humans and other ape species. Even though these inserted retroviruses insert all over the place in genomes we find the same insertions at the same base in multiple ape species which indicates a single insertion in a common ancestor.

Eric said...

Did we have to stop teaching the Central Dogma (DNA to RNA to Protein) in schools because we discovered viral reverse transcriptase? No. It is still taught because it is still true for all of the important processes in prokaryotic and eukaryotic cells.

Finding small exceptions to the general rule does not mean that we have to throw out the general rule. The vast, vast majority of differences between species is still sculpted by random mutations and selection. That is why it is still taught.

Faizal Ali said...

I'll save Larry the trouble of posting his previous explanation of how reverse transcriptase does not violate the Central Dogma:

Basic Concepts: The Central Dogma of Molecular Biology

Eric said...

@Arlin

"QED, the neo-Darwinian position isn't falsifiable."

You can falsify the neo-Darwinian position by showing that none of the differences between species is due to random mutations and natural selection. You can falsify the theory by showing that there is no phylogenetic signal in the morphological and genetic data.

Bill Cole said...

John
"There are no "mixed DNA sequences of the ostrich". I thought we had gone through that before. This too is your imagination. Now why should three losses of flight cause any skepticism?"

Why does the ostrich share a later ancestor then the other paleognaths?
From the limited DNA sequences in your paper I see commonality with both flightless and flighted birds.

How would you validate a multiple losses of flight hypothesis without UCD assumed?

Bill Cole said...

John
"No. It's a scientific method, but there are other models of science."

What are the other models of science and how would you compare and contrast them with the 5 step model I cited.

Faizal Ali said...

Here's one.

Form a hypothesis.

Predict what observations would be made if such a hypothesis was true, and which observations would falsify it.

See what observation are actually made.

Doesn't that seem like science, Bill?

BTW, why to you insist on asking increasingly picayune and irrelevant questions while you ignore the very basic and important questions that have been asked of you?

John Harshman said...

There are all manner of models. One that was used in the paper at hand is a simple one: simultaneous comparison of all credible hypotheses, rejecting those that don't fit the data and accepting compatible portions of the remainder, while reserving judgment on incompatible portions.

At bottom, science is just the use of empirical observations to reject some hypotheses and provisionally accept others. And I concur with lutesuite that you seem to be asking all these questions to avoid confronting the real issues, including that there is very good evidence for common descent. I assume that's because you don't want, for religious reasons, to accept the conclusion.

John Harshman said...

Why does the ostrich share a later ancestor then the other paleognaths?

That was incoherent. I don't even know what you meant to ask. The limited sequence in the paper is from a figure showing one indel and serves no function other than to show you the indel. The sequences and alignments are freely available if you want to look at the actual data. All birds share characters because they are all descended from a common ancestor. Characters shared by ostriches and neognaths are those present in the common ancestor of all birds.

How would you validate a multiple losses of flight hypothesis without UCD assumed?

That was slightly less incoherent. UCD = universal common descent, referring to all life: archaeans, eubacteria, eukaryotes. That has nothing to do with relationships among the tiny twig on the tree of life we call Metazoa, much less birds. Now, the inference of multiple losses of flight does rest on acceptance of the phylogenetic tree, but that tree is not simply assumed; it's a conclusion from extensive analysis of the data. Science is a method for drawing reliable conclusions about the world, and this often involves building new conclusions on the basis of prior ones. That's why the accent has to be on "reliable". Phylogenetics is no different in this respect from any other branch of science.

Eric said...

Bill Cole,

"How would you validate a multiple losses of flight hypothesis without UCD assumed?"

Loss of flight is not a morphological feature. That would be the first problem. If flying fish lost their ability to glide above water, we would not put them close to ostriches on a phylogenetic tree. Losses of an ability are not diagnostic features.

As to your steps in the scientific method, evolution is easily tested using this model.

Ask a question: Why do both humans and chimps have hundreds of thousands of endogenous retroviruses (ERVs) in their genomes?

Hypothesis: Humans and chimps inherited the bulk of these ERVs from a common ancestor. Due to the random nature of retroviral insertion, ERVs inherited from a common ancestor should be found at the same location in each genome.

Experiment: Map ERVs in the human and chimp genome to see if they are found at the same base in each species.

Results: More than 99% of the ERVs in the human and chimp genomes are found at the same location.

Conclusion: Humans and chimps inherited more than 99% of their ERVs from a common ancestor.

Faizal Ali said...

Don't be hasty, Eric. What about this hypothesis:

God created humans and chimps separately, but wanted to trick us into believing they share a common ancestor.

Prediction: Molecular genetics would provide overwhelming evidence for the common ancestry of humans and chimps, because God's tricky like that.

Observation confirms the prediction.

Conclusion: God created humans and chimps separately.

Checkmate, atheists!

Bill Cole said...

Eric
Thanks for your analysis on human and chimps using the 5 step scientific method. Can you help with the following question without invoking the common descent inference.

How do birds lose the ability to fly and survive as a specie?

Bill Cole said...

John

"Now, the inference of multiple losses of flight does rest on acceptance of the phylogenetic tree, but that tree is not simply assumed; it's a conclusion from extensive analysis of the data"

Thank you

"All birds share characters because they are all descended from a common ancestor. Characters shared by ostriches and neognaths are those present in the common ancestor of all birds."

Again you are pointing to the common ancestor hypothesis for your argument.

As Eric points out there is evidence the supports this hypothesis but in your paper there is also evidence that contradicts it. How would you support multiple losses of flight without assuming a common ancestor?

Faizal Ali said...

How do birds lose the ability to fly and survive as a specie?

Do you think ostriches, emus and penguins are imaginary, Bill?

Faizal Ali said...

As Eric points out there is evidence the supports this hypothesis but in your paper there is also evidence that contradicts it.

Such as...?

How would you support multiple losses of flight without assuming a common ancestor?

This is like asking "How could you support things falling down without assuming gravity?"

Why don't you answer some of the questions you have been asked, rather than trying to cover your ignorance by asking what you think are clever "gotcha" questions, but which are really just incoherent nonsense?

judmarc said...

How do birds lose the ability to fly and survive as a specie?

Yeah, the dinosaurs were practically a flash in the pan.

Anonymous said...

Bill wrote: "How would you support multiple losses of flight without assuming a common ancestor?"

To which I can only respond: Why would you support multiple losses of flight without assuming a common ancestor? And given the evidence that all birds have a common ancestor, why wouldn't you assume that they have a common ancestor when reasoning about their evolution?

Anonymous said...

Pet peeve:

Species is both a singular and a plural noun, like sheep. One species, two species, etc.

Species is a financial term referring to coins.

It's a small point, but surely you can get it right.

Anonymous said...

Drat! I typed it wrong!

Specie is a financial term referring to coins.

It's a small point, but surely you can get it right, possibly more often than I do.

John Harshman said...

Bill, I have little to add to my previous responses and those of others. You keep on asking the same long-ago-answered questions as if you had never seen the answers. But I'll do it again, expecting no comprehension this time either.

That birds share characters due to common descent is not an assumption. Common descent is an explanation for that sharing. If there were another explanation as good or better, we would not be able to reject it. However, there is no such alternative explanation. This is how science works: you try out explanations against each other and reject any that don't fit the data in favor of those that do.

Now, once you have been able to reject all the alternatives with high confidence, you can consider that explanation to be true, i.e. assume it for other purposes, at least until a better explanation comes along. Thus we find birds to have common ancestry, since it's the one explanation that fits the data. And we can then assume that ancestry to decide that flight was lost several times. (It was actually lost hundreds of times, mostly in rails on Pacific islands.)

How species survive without flight is an interesting question. But it hardly seems like an objection to flightless birds being descended from flying ancestors, does it?

christine janis said...

"That hardly matters."

It's the only indicator that what you are writing has any credibility. I, myself, am writing the next Great American Novel. Trust me.

Anonymous said...

Dear CMJ,
please check PUBMED out for Arlin Stoltzfus and reconsider your statement...
I didn't like Arlins attack on Ernst Mayr either and I did't get everything he said in the discussion with Eric and others (which might be due to either MY misunderstanding [I'm no expert and neither are you I presume] or the lack of clarity by Arlin in his statements) but you should inform yourself a little bit better.
Cheers,
Michael Leichter

Paul McBride said...

Wow. Michael, you just told someone to check out another poster's publication record, because you assumed she didn't know about it before commenting, and yet you failed to check her publication record before yourself assuming she's "no expert". Whoops...

Anonymous said...

@ Paul McBride: point taken. Stupid me!
@ CMJ: I apologize for the 'and neither are you I presume' (I presumed wrongly, obviously)

I just didn't like the in my opinion unwarranted
statement: 'It's the only indicator that what you are writing has any credibility.'

Arlin said...

@leichterverstehen, you write "I believe it is nonsense to compare the importance of mutations and selection for evolution against each other. Both are part of the game. It is a non-discussion."

This argument does not hold up to scrutiny, e.g., genes and environment both are necessary for phenotypes to develop, but that doesn't mean we can't make statements about relative influence. The same is true for mutational or developmental biases in the introduction of variation, and biases in the reproduction of variation (selection). This point is demonstrated in Yampolsky & Stoltzfus, 2001, but it is easier to read about in Stoltzfus and Yampolsky, 2009 Climbing mount probable: mutation as a cause of nonrandomness in evolution. J Hered. 100(5):637-47. doi:10.1093/jhered/esp048.

The 2001 paper has been cited about 65 times. I'm saying this only because some papers are published and no one reads them. In this case, however, the paper has received enough attention by now that, if it were crap, it would have been exposed as crap.

Arlin said...

@Eric, ROTFL. "You can falsify the neo-Darwinian position by showing that none of the differences between species is due to random mutations and natural selection. " So, if *any* differences are due to random mutation and selection, then neo-Darwinism is true. The only way for it to be false is if *none* of the differences are due to random mutation and selection? If 50 % of the differences are due to de Vriesian macromutations, and 30 % are due to Lamarckian variations, and 19 % are engineered by space aliens, and 1 % are due to random mutation and selection, then neo-Darwinism is true?

Eric, either you are going to explain that this was a typo, or I am done wasting my time with you. That is the stupidest thing I've ever seen.

Arlin said...

Wow, @Christine Marie Janis, the level of complacency here is stunning. Having a publisher "is the only indicator that what you are writing has any credibility"?

What about, um, actually reading what I wrote, and maybe asking if it holds together logically, and maybe checking some of the sources to see if they fit? So that, um, you don't look like such a fool when it turns out that everything I'm saying is well founded?

Eric keeps saying I'm "ignoring" the "research" that shows CRISPR isn't important, but so far as we know *there is no research*. He hasn't cited any research investigating the evolutionary importance of CRISPR. If he knew of any actual "research", then he could cite a paper with a scientific assessment of the evolutionary impact of CRISPR. Maybe such papers exist. I haven't seen them myself, but I wouldn't rule it out (nearly all the literature on CRISPR is from a biotech standpoint, unfortunately, and doesn't address evol issues). Eric just keeps waving his hands, multiplying numbers together, and claiming that it is all obvious (I've explained already why the answer is not obvious), most recently exposing his lack of awareness that prokaryotes-- the dominant organisms on the planet for the past 4 BY-- are the go-to case for resolving what is important in evolution.

If I have strong beliefs about something happening or not happening at a distant time or place that neither I nor anyone else has seen, e.g., if I assert that there is no life on other planets, or if CRISPR can't have been important in evolution, this must be because I have some faith, some theory, or some inner pipeline to the truth. From the start, Eric the instant expert has been making confident claims about things of which he can't possibly have acquired direct knowledge. He hasn't made the basis of his inner beliefs clear, but the language sounds like neo-Darwinism, an old theory developed back in the 20th century, before the molecular biology revolution. In neo-Darwinism, "The ultimate source of explanation in biology is the principle of natural selection" (Ayala, 1970). This view holds that mutation is "ultimately necessary" for evolution, but then bends over backward to insist that mutation is "random" and merely a source of "raw materials", and nothing about it influences the outcome of evolution. For followers of Darwin, the idea that there are internal sources of direction in evolution is one of the great bogeymen: they are taught to react with suspicion to any such claims, and to reject them as appeals to mysticism rather than to explore them as scientific alternatives.

judmarc said...

Hi Arlin - I'm curious about how you think CRISPR-Cas may have originated in the lineages where we see it today. If you've got a publication that sheds some light on this, I'll take a citation as an answer.

Thanks.

christine janis said...

"please check PUBMED out for Arlin Stoltzfus and reconsider your statement..."

I apologise for being flippant. But what set me off was the comment "it hardly matters". Anyone can claim to be writing a book. All he had to do was to say something like "I've had others published" (or "plenty of articles published" or similar)

Eric said...

@Arlin
"Eric keeps saying I'm "ignoring" the "research" that shows CRISPR isn't important, but so far as we know *there is no research*."

This paper would be a good place for you to start:

http://www.sciencedirect.com/science/article/pii/S0300908415001042

It shows how viral DNA is inserted into CRISPR sites, and these CRISPR sites make up a fraction of the overall genome. CRISPR specific activity is limited to these CRISPR sites. The section on CRISPR diversity, ecology and evolution would be worth your time.

I really don't know what else to do other than keep pointing you to the research you claim doesn't exist. Perhaps you may actually read it this time. Who knows. Until then, the fact remains that CRISPR specific activity is limited to well defined and limited regions of the genome, meaning that the vast majority of the genome evolves through random mutations and natural selection.

Arlin can't seem to accept these facts, which is why they keep getting ignored. CRISPRs aren't as important as classic neo-Darwinian mechanisms because they aren't as common as classic mechanisms. That's what it boils down to.

Eric said...

@Bill,

Why couldn't birds survive without flight? Seems to be a strange question to ask.

Look at fish who lost the ability to swim and live in water. They became us, and other terrestrial tetrapods. If there is no penalty for losing a feature, then you lose that feature. That's the way evolution works.

Eric said...

@Bill,

Multiple and independent losses of flight does not contradict common ancestry or evolution. It never has.

Jonathan Badger said...

Late to the party, but what in particular do you think is worthwhile in Noble's views? I ask because I've read your book on biochemical evolution and would have thought you'd be the last person to be supportive of the sort of "holistic" attacks on "reductionism" that he favors.

Faizal Ali said...

It's just stupid beyond belief for someone to question whether birds can survive without the ability to fly, in the midst of a discussion on the phylogenetics of ratites. How do these people think?

judmarc said...

Until then, the fact remains that CRISPR specific activity is limited to well defined and limited regions of the genome, meaning that the vast majority of the genome evolves through random mutations and natural selection.

CRISPRs aren't as important as classic neo-Darwinian mechanisms because they aren't as common as classic mechanisms.


Would you agree omething that helps an organism (and species) survive attempts at killing it through infection is surely important in an evolutionary sense despite being a relatively rare occurrence?

After all, incorporation of the mitochondrion may only have happened once, thus being extremely rare, but in an evolutionary sense one might well consider it important.

Eric said...

@judmarc

We have to define what we mean by "important". If we are talking about the evolution of a bacterial lineage, what are the important things we are looking at? What are the questions we have?

In nearly every instance, what we are interested in is metabolic pathways, cell morphology, cell wall content, surface proteins, extracellular proteins that affect other bacteria or eukaryote host cells, proteins involved in cell mobility, and so forth. CRISPR has nothing to do with these features. That is why it is way down on the list of important things to look in bacterial evolution.

To use another analogy, let's say we have Diseases A and B. Disease A kills 100 million people a year. Disease B kills 10 people a year. Which disease would be considered more important when it comes to scientific study? Are we being dismissive of the 10 people who died of Disease B if we think that it is more important to study Disease A?

Bill Cole said...

Eric
"Multiple and independent losses of flight does not contradict common ancestry or evolution. It never has."

I realize that it alone does not contradict evolution but it is evidence that needs to be explained. Losing flight requires lots of genetic changes. It is not obvious how this happened and raises questions about the common descent inference. I also think the combination of flighted and non flighted DNA sequences in the ostrich introns in John's paper also raises questions about the common descent inference.

John Harshman said...

Once again, Bill, you do not see to understand my paper. There is no combination of flighted and non flighted DNA sequences in the ostrich introns. Can I say that louder? THERE IS NO COMBINATION OF FLIGHTED AND NON FLIGHTED DNA SEQUENCES IN THE OSTRICH INTRONS. Will you notice it this time?

Losing flight is actually pretty simple. All you need is for birds to get heavier and their wings to get smaller, for which there are obvious selective reasons if the species in question are no longer interested in flying. Loss of flight has happened over a thousand times during bird evolution, 700 times that we know of in one family, Rallidae, alone. It raises no questions about the common descent inference. IT RAISES NO QUESTIONS ABOUT THE COMMON DESCENT INFERENCE. Sorry to shout, but you don't seem to have noticed the last several times I told you this.

Jmac said...

Losing flight is actually pretty simple. All you need is for birds to get heavier and their wings to get smaller, for which there are obvious selective reasons if the species in question are no longer interested in flying. Loss of flight has happened over a thousand times during bird evolution, 700 times that we know of in one family, Rallidae, alone. It raises no questions about the common descent inference. IT RAISES NO QUESTIONS ABOUT THE COMMON DESCENT INFERENCE. Sorry to shout, but you don't seem to have noticed the last several times I told you this.

Yeah...Dr. Harshman is so sure of his claims because "he has scientific proof to support his claims"...

Well, unfortunately that would be true in the real world of true science...However in the world of imaginary science, pretty much anything is possible as long as you have the bully power to enforce it. Hitler and other dictators have done it... The Darwinian religion has had that for a while now but it's loosing its grip because of the internet. Now, almost anyone can do research and make up his mind... Darwinists don't like it because they are loosing their grip, that is why they are holding the Royal Distraction Meet. It's not about who is right or wrong... No way... It is about keeping the DEAD Darwinian faith on a respiratoer in the hopes on resurrection...

Larry is delusional if he thinks that his drift theory is going to have an impact...
The Royal Society Meeting is about maintaining the religion This is not going to be a reformation of this particular type of religion, well not yet, but it may be in the future but not by Darwinists...

Arlin said...

Eric, I'm going to go through this one last time, s l o w l y. If you still don't get it, I give up.

The issue is not how CRISPR works, but the extent to which, over the 100s of millions of years that CRISPR systems have been widespread in the living world, these systems have been important in evolution. We might ask the same question about some other curious aspect of genetics, like lateral transfer, or transposons, or biased gene conversion. How would we go about doing research, not just on the genetics of these things, but on their *importance in evolution*? Certainly it is not a simple issue.

Eric's approach is to note that (1) CRISPR systems are "only" found in prokaryotes where they occupy a small fraction of the genomes, and then to extrapolate that (2) the fraction of mutations fixed in evolution corresponds to this small fraction, and (3) the evolutionary importance or impact of these CRISPR-associated hanges are also a tiny fraction of what is "important".

While this kind of hand-waving may work well in Eric's world, I am a researcher. We certainly use hand-waving arguments, but we don't pretend that they resolve the issue, and we don't refer to them with the word "evidence." Eric's assumptions are not a given. It might be that what is important in prokaryotic biology is escaping from the latest phage attack, and that the 2 % (or whatever) of the genome devoted to CRISPR is the locus of 20 % of the changes. Then Eric's claim that CRISPR is unimportant would be mistaken.

The paper that Eric cites does nothing to confirm his speculations. This paper does not even represent research on the *evolutionary importance* of CRISPR. It is mainly just reviewing how the system works and so on. To the extent that the authors make comments on the importance or role of CRISPR in evolution, they are largely ambiguous. However, they clearly do not accept the basis of Eric's argument, because they are not prepared to make a conclusion about CRISPR solely on the basis of its role in defense, speculating that it might have other roles:

"Although most studies on CRISPR-Cas systems points to its pre-dominant role as protection against invading genetic material, its involvement in other cellular processes such as regulation of virulence, genome evolution and DNA repair is becoming increasingly evident. In most cases the processes behind the alternative functions are not well known and further investigations are required to bring clarity to the matter."

Note the words "further investigations are required". This is the attitude of the researcher.

Arlin said...

Actually, the paper that Eric cites actually cites evidence *against* Eric's assumption labeled 2 above. They cite the work of Tyson & Banfield 2008, to the effect that CRISPR loci were changing so rapidly in certain biofilms that no two individuals were the same. See the comment " On the other side of the scale, in an analysis of acid mine drainage, extreme CRISPR diversity was observed where no two sampled individual cells had the same spacers [27]", where ref 27 is Tyson and Banfield.

Jmac said...

Losing flight is actually pretty simple. All you need is for birds to get heavier and their wings to get smaller, for which there are obvious selective reasons if the species in question are no longer interested in flying. Loss of flight has happened over a thousand times during bird evolution, 700 times that we know of in one family, Rallidae, alone.

Let Dr. Harshman prove the opposite. Let's put Rallidae family on a diet and treadmill; let them do some regular stretches of the wings and see if they are going to try to fly again...

I'm sure people who see the absurdity of evolution get my point. People who are married to evolution no matter what, don't what to see it. They refuse to see it... Well, why bother arguing with them?

judmarc said...

I'm sure people who see the absurdity of evolution get my point.

And conversely, people who see the absurdity of your point get evolution. :-)

Bill Cole said...

John
"Once again, Bill, you do not see to understand my paper. There is no combination of flighted and non flighted DNA sequences in the ostrich introns. Can I say that louder? THERE IS NO COMBINATION OF FLIGHTED AND NON FLIGHTED DNA SEQUENCES IN THE OSTRICH INTRONS. Will you notice it this time?"

Tinamus cagcactc-agcttct----------tttcttccgtatt
ostrich cagcactc-agcttctaagcttatttccccctcact
Anas gagcgccccagtttctaagtcctgaggtctctttctt

Copied poorly from your paper I see sequence commonality from the ostrich and the anas (neognath) and the tinamous (paleognath's).

Also, in your tree you have the ostrich as a paleognath with the only direct ancestral relationship with the neognath's.

http://www.pnas.org/content/105/36/13462/F2.expansion.html

Bill Cole said...

Here is a link to your sequence data that lines much better than my scribble.

http://www.pnas.org/content/105/36/13462/F2.expansion.html

Bill Cole said...

Your conclusion to the above link.
"An 8-bp deletion in ALDOB supports ratite polyphyly. (A) Alignment of the region around the informative deletion in ALDOB (positions 3213–3220). The ostrich shares its character state (+8 bp) with neognaths, whereas tinamous share the character state of all other ratites (−8 bp). (B) The distribution of character states can be mapped as a single deletion on the optimal topology found in this study. (C) The distribution requires at least two steps on the traditional topology (one possible reconstruction shown)."

Anonymous said...

Bill, the region "taagctta" can't reasonably be described as a "flighted" bit of DNA. It has nothing to do with flight itself. It's a bit of DNA that occurs in several diverse flying birds and no doubt some of their non-flying relatives (e.g. many rails, Kakapoo, etc.) though that wasn't tested in this article. It occurs in the Ostrich.

This bit was lost at some point in evolution. When? Among the ancestors of ratites, after the Ostrich evolved and before the tinamous and most of the ratites evolved. The shared loss is evidence that tinamous, rheas, emus, kiwis, etc. shared a common ancestor more recent than their common ancestor with ostriches, which in turn is more recent than their common ancestor with neognaths, etc.

John Harshman said...

Bill,

Again, you don't understand what you read. The 8 bp you refer to were present in the common ancestor of all extant birds and lost in the common ancestor of extant paleognaths other than ostrich. That's the 8 bp deletion the quote talks about. This does not link the ostrich with neognaths, if that's even what you were trying unsuccessfully to say. It also isn't clear to me what you could possibly mean by "direct ancestral relationship with the neognath's", but I suspect that you don't know how to interpret a phylogenetic tree. The tree shows that paleognaths form a group, that neognaths form a group, and that paleognaths other than the ostrich also form a group. Whatever else you think you see is in your imagination only.

judmarc said...

Perhaps we can conclude that the "design inference" handicaps reading comprehension of scientific papers related to evolution?

Bill Cole said...

John
"That's the 8 bp deletion the quote talks about. This does not link the ostrich with neognaths, if that's even what you were trying unsuccessfully to say"

Am I mis interrupting your tree that the ostrich has the closest ancestral relationship with neognaths of all the paleognath's?

" but I suspect that you don't know how to interpret a phylogenetic tree. The tree shows that paleognaths form a group, that neognaths form a group, and that paleognaths other than the ostrich also form a group. Whatever else you think you see is in your imagination only."

I certainly don't know how to interpret a tree.

"This bit was lost at some point in evolution. When? Among the ancestors of ratites, after the Ostrich evolved and before the tinamous and most of the ratites evolved. The shared loss is evidence that tinamous, rheas, emus, kiwis, etc. shared a common ancestor more recent than their common ancestor with ostriches, which in turn is more recent than their common ancestor with neognaths, etc."

Do you agree with B Wilsons explanation?

Faizal Ali said...

How would the ostrich avoid losing these 8bp?

Holy fuck. You really don't understand the first thing about genetics,do you?

Anonymous said...

Bill Cole: "I certainly don't know how to interpret a tree."

And yet, he is arguing persistently with John Harshman, who knows how to interpret a phylogenetic tree, about how a tree in Harshman's own research should be interpreted.

Perhaps Bill Cole should consider the First Law of Holes. Or take a beginning genetics class. (It wouldn't cover phylogeny reconstruction, but it would be of use in understanding the basics.)

Faizal Ali said...

Oh, Bill, Bill, Bill:

Am I mis interrupting your tree that the ostrich has the closest ancestral relationship with neognaths of all the paleognath's?

LOL! How many errors can one fit into a single sentence (and I'm not even including "mis interrupting.")

Anonymous said...

All paleognaths in this tree are equally closely related to the neognaths. All trace back to the same common ancestor that is outside the main neognath clade.

However, Ostriches are basal on the paleognath tree. They are in some way (specifically that 8 bp sequence) more similar to the neognaths than any other living paleognaths.

John Harshman said...

Bill,

"closest ancestral relationship" is not a thing. The only way to reinterpret that statement to make any kind of sense is that the ostrich and neognaths are both outside the group that includes the other paleognaths. And this is true. This does not mean that ostriches are more closely related to neognaths than any other paleognaths are; the other paleognaths and ostriches are in fact equally closely related to neognaths. The other paleognaths are just more closely related to each other than to the ostrich.

I don't like a few of the ways bwilson said what he said, but the substance is more or less correct. Let me restate it in a way I like better. The common ancestral species of all living birds split into two species, one of which was the ancestor of all paleognaths and the other the ancestor of all neognaths. At this point, both species had that 8bp. The common ancestor of the neognaths proceeded to speciate like crazy but we won't consider it any further except to note that all its descendants seem to have retained those 8bp.

Back to the common ancestor of all paleognaths. It split into the ancestor of ostriches and the ancestor of all other paleognaths. Everyone at this point still had those 8bp. On the ostrich lineage, we eventually got living ostriches, and they still have the 8bp. The other paleognath lineage eventually splits too, giving rise to the ancestors of the other living paleognaths. But at some point before that happened, some population in that lineage lost 8bp, and that deletion was inherited by all its descendants, who still show it today.

Is that clear?

Anonymous said...

John Harshman, Your explanation of what I tried to say is clearer than mine.

By the way, "she" would be appropriate, but you couldn't know from "bwilson." It's theoretically possible I should use a more complete name, but I feel so lucky that I got any account to work that I'm not going to change.

John Harshman said...

Noted. I always thought Bwilson was a boy's name.

Bill Cole said...

John
"Is that clear?"
Yes, it is clear and a solid explanation if you assume common ancestor among all birds.

Faizal Ali said...

Oh, Bill. You're such a card.

So why don't you give us your alternative explanation for John's findings, using your extensive knowledge of phylogenetics? Please provide the evidence that demonstrates that all species of birds are completely unrelated to one another, and were instead each specially created (or whatever you think happened).

More specifically: What is the explanation, other than common descent, that better explains the data that led John to formulate that phylogenetic tree (that you admit to being too ignorant to understand but which you nonetheless still insist you know to be wrong)?

Bonus points for explaining the finding you found so puzzling: That the common ancestor of all ostriches was somehow able to pass on an 8bp sequence of DNA to all its descendents.

John Harshman said...

Bill,

That 8bp deletion is actually a bit of evidence for common descent, you know. Common descent is a conclusion, not an assumption. Is that clear? As lutesuite has mentioned, do you have an alternative that explains the data?

Faizal Ali said...

@ John Harshman

The 8bp deletion is not what's most troubling Bill. He somehow cannot figure out how the deletion did not occur in ostriches. That is his level of understanding of this topic, and what you are working with in your valiant attempts to explain it to him. You have my best wishes for success, as well as my sympathy.

Eric said...

@Arlin,

That is the stupidest reply I have ever read. If all you can do is dismiss everything I write without addressing any of it, we probably are done.

If 50% of the differences are due to random mutations, then 50% of differences are due to random mutations. Pointing to non-random mutations does not change the fact that random mutations do occur.

As it is, 99.9999% of all DNA changes are random mutations. Pointing to the few exceptions does not make those random mutations go away.

judmarc said...

Yes, it is clear and a solid explanation if you assume common ancestor among all birds.

To paraphrase lutesuite, holy s**t. You have to really be trying hard not to understand the obvious implications of the data at this point. This is what I meant by the design inference handicapping comprehension, what John Harshman meant by his statement that common descent is a conclusion from the data rather than an assumption, and what lutesuite has meant by a series of comments, starting with that "Holy f**k."

Bill Cole said...

John
"
That 8bp deletion is actually a bit of evidence for common descent, you know. Common descent is a conclusion, not an assumption. Is that clear? As lutesuite has mentioned, do you have an alternative that explains the data?"

I don't have a better alternative. Can you explain how the deletion supports common descent among all paleognath's?

Common descent is both and conclusion based on data and an assumption used to interpret data. Loss of flight is a conclusion based on the assumption of common descent.

Faizal Ali said...

I don't have a better alternative.

Do you have one that is as good? Or that is even an explanation at all?

Can you explain how the deletion supports common descent among all paleognath's?

What's wrong with the explanations you've already received? And if you have no explanation yourself, why are you even still talking about this?

Faizal Ali said...

Common descent is both and conclusion based on data and an assumption used to interpret data. Loss of flight is a conclusion based on the assumption of common descent.

Why won't you say it's a conclusion based on the "conclusion based on data" that is common descent? The illogical nature of your position could not be more obvious if you tried.

John Harshman said...

Bill,

The deletion doesn't support common descent of all paleognaths. It supports common descent of all paleognaths other than ostriches. Do you also need that explained?

You are at least correct that a conclusion from one analysis can be used as an assumption in another. That's how scientific progress works. Do you consider that a bad thing?

I have to say that I agree with others here that your resistance to simple conclusions drawn from overwhelming support by data is puzzling to understand unless you are strongly committed to some contradictory belief. You claim to be impartial, but all evidence suggests otherwise. You are clearly some kind of creationist, even if you won't admit it here.

Bill Cole said...

John
" The deletion doesn't support common descent of all paleognaths. It supports common descent of all paleognaths other than ostriches. Do you also need that explained?"

I agree that was also my conclusion.


"You are at least correct that a conclusion from one analysis can be used as an assumption in another. That's how scientific progress works. Do you consider that a bad thing?"

Its not a bad thing but something to be aware of. In physics some faulty analysis has been done based on mis understanding the second law of thermodynamics.

"I have to say that I agree with others here that your resistance to simple conclusions drawn from overwhelming support by data is puzzling to understand unless you are strongly committed to some contradictory belief. You claim to be impartial, but all evidence suggests otherwise. You are clearly some kind of creationist, even if you won't admit it here."

The evidence IMHO seems to favor us living in a created universe vs a random accident. As far as universal common descent goes I am highly skeptical based of difficult origins like eukaryotic cells, multicellularity, vertebrates, mammals and humans. As far as common descent among birds, I am completely open to the data.

John Harshman said...

As far as common descent among birds, I am completely open to the data.

Clearly that is not true, given your many attempts to reject the conclusions of one simple, easily understood (if I do say so myself) publication, among many. The universe was not under discussion. The rest (eukaryotic cells, etc.) are pretty well understood. I don't think you have looked into the literature at all. Why not come clean and admit you have a prior creationist bias?

Faizal Ali said...

The evidence IMHO seems to favor us living in a created universe vs a random accident.

The "IMHO" of a dishonest ignoramus holds no scientific validity.

Bill Cole said...

John
"The rest (eukaryotic cells, etc.) are pretty well understood. I don't think you have looked into the literature at all. Why not come clean and admit you have a prior creationist bias?"

I told you that I think the evidence supports a created universe so yes, this creates bias.

I agreed with your conclusion that you came to after a lot of discussion.

I think that your paper was a solid scientific document unlike many that are evolutionary "just so" stories.

John Harshman said...

I told you that I think the evidence supports a created universe so yes, this creates bias.

Perhaps you should try harder to correct for this bias if you are in search of truth. If. But what does the origin of the universe have to do with the evolution of life? And let's not get into your supposed evidence that the universe was designed.

I think that your paper was a solid scientific document unlike many that are evolutionary "just so" stories.

Is it possible you have misinterpreted these "many" as badly as you misinterpreted mine? I ask you to consider at least the possibility.

Bill Cole said...

John
"Is it possible you have misinterpreted these "many" as badly as you misinterpreted mine? I ask you to consider at least the possibility."

I will.

judmarc said...

I will.

That's a good thing. I very much hope it turns out well for you. There's so much amazing stuff to learn.

ElShamah777 said...

Cornelius Hunter posts an interesting say of Denis Noble:

I would say that it needs replacing. Yes. … The reasons I think we’re talking about replacement rather than extension are several. The first is that the exclusion of any form of acquired characteristics being inherited was a central feature of the modern synthesis. In other words, to exclude any form of inheritance that was non-Mendelian, that was Lamarckian-like, was an essential part of the modern synthesis. What we are now discovering is that there are mechanisms by which some acquired characteristics can be inherited, and inherited robustly. So it’s a bit odd to describe adding something like that to the synthesis ( i.e., extending the synthesis). A more honest statement is that the synthesis needs to be replaced. … By “replacement” I don’t mean to say that the mechanism of random change followed by selection does not exist as a possible mechanism. But it becomes one mechanism amongst many others, and those mechanisms must interact. So my argument for saying this is a matter of replacement rather than extension is simply that it was a direct intention of those who formulated the modern synthesis to exclude the inheritance of acquired characteristics. That would be my first and perhaps the main reason for saying we’re talking about replacement rather than extension.

Bodyform depends on various mechanisms. Which go far beyond the mechanisms proposed by Darwin.......

Faizal Ali said...

What we are now discovering is that there are mechanisms by which some acquired characteristics can be inherited, and inherited robustly.

Yeah, except that's simply false. So Hunter is, as usual, just talking out his ass.

Jass said...

lutesuite,

Why don't just simply say you don't like it because it "pulls the rug from under your feet" on your predetermined stand of your beliefs? You will just stick to your belief system no matter what evidence brings. Why don't you have the gust to announce it? Well, at least you are not alone. Look at the host of this blog, R. Dawkins, PZ, Myers, J. Coyne, and many others. They are unmovable stumbling blocks and proud of it.

Faizal Ali said...

Hi, Velhovsky. I couldn't help but noticing that your post neglected to give any examples of these "mechanisms by which some acquired characteristics can be (robustly)inherited." I'm sure that was a mere oversight on your part,right?

Faizal Ali said...

Just a slight correction: It seems Otangelo was not quoting Hunter, but Noble. So it was the latter who was talking out his ass.

http://www.huffingtonpost.com/suzan-mazur/replace-the-modern-sythes_b_5284211.html

Anonymous said...

Velhovsky,

Don't be such an idiot. Atheism does not need evolution to have a single mechanism, let alone that such mechanism was the very same mainly proposed by Darwin so long ago. All atheism rests upon is the lack of convincing evidence for those fantasies called gods. Evolution, one mechanism or many, has nothing to do with the lack of evidence for gods.

Start thinking. Atheism isn't about having explanations about everything, or about being stuck into a single scientific idea. Atheism is just about the lack of convincing evidence for gods.

Do you even understand this?