More Recent Comments

Wednesday, March 25, 2015

Another successful prediction of Intelligent Design Creationism?

The genetic code is redundant. Many amino acids have multiple codons ranging from two to six. The different codons for the same amino acid are called "synonymous" codons.

As sequences of protein-coding genes began to accumulate in the 1980s, it became apparent that different synonymous codons were used preferentially in different species. The phenomenon became known as codon bias. By 1990 it was known that the frequency of codon usage was correlated with tRNA abundance. As a general rule, there is a different tRNA for each codon and if multiple codons exist for a given amino acid then insertion of that amino acid into protein will depend on different tRNAs carrying the same amino acid.

Highly expressed genes are enriched for those codons with abundant tRNAs. This maximizes the speed of translation. Most of the first genes that were sequenced were highly expressed and that's why codon bias showed up so early. As more and more genes were sequenced we often saw that there was no preferential use of the "biased" codons.

There may be examples of genes that selected for rare codons in order to slow down translation and reduce the amount of protein being produced but there aren't many examples.

The idea that synonymous codons aren't always neutral has been around for decades but every now and then some science journalist discovers it for the first time [A Breakthrough in Gene Expression?] [Silent Mutations and Neutral Theory]. And it doesn't stop the Intelligent Design Creationists from claiming that it somehow disproves evolution and confirms a prediction by IDiots [Another stupid "prediction" by Intelligent Design Creationists].

Now they're at it again. The latest paper shows that by slowing down translation, the mRNA becomes less stable (duh!). Thus, rare codons play a role in regulating gene expression. This leads Casey Luskin to announce: Another Successful Prediction of Intelligent Design: Cell Paper Reports Functions for Synonymous Codons.
ID, on the other hand, predicts that we should find deeper and deeper layers of function in biology. That's why functions for synonymous codons represent a successful prediction for ID, and a big problem for Darwinian evolution.
I don't recall that ID predicted codon bias back in the early 1980s. Do you?

And I don't recall a lot of angst at the time because this was a big problem for Darwinian evolution.


135 comments :

SRM said...

Wait till the IDers discover the ribosome-pausing mechanism that regulates expression of the Trp biosynthetic genes in bacteria via the formation of a transcription terminator. If that system doesn't have the fingerprints of god all over it, I don't know what does.

Joe Felsenstein said...

Larry: In headline, "design". In post: "Casey Luskin"

Diogenes said...

OK. I'm going to throw some bombs around. Consider this Luskinism:

"ID, on the other hand, predicts that we should find deeper and deeper layers of function in biology."

Yeah, before I was silently banned from UD the second time (I'm on my third silent banning now, last time I checked, KTHNX Denyse O'Sneery) I go into an argument with the UDites over Junk DNA. I kept asking them: "How can you make predictions about whether there's junk DNA unless you know the purposes of God? And if your hypothesis assumes knowledge of the purposes of God, doesn't that make ID a religious belief?" and they all responded with the usual UDism: insults and evading the question.

Now on this Luskinism: "ID, on the other hand, predicts"-- note that Luskin anthropomorphizes ID as if it were a person proclaiming grand proclamations, as opposed to a hypothesis that has logical entailments that can be tested via its entailments.

But let's ask: how can ID "predict deeper and deeper levels of function" unless it knows the purposes of God? And if your hypothesis assumes knowledge of the purposes of God, doesn't that make ID a religious belief?

Here we have to distinguish between that ID that assumes it knows the purposes of God, and that ID which blogger Jack Scanlan calls "bare ID", which does not assume it knows the purposes of God. I prefer to call this distinction teleological ID vs. non-teleological ID. They're both garbage, but they're garbage for different reasons.

Only teleological ID can make predictions, and it can only make predictions by assuming it knows the purposes of God. In principle, only tele-ID can be tested.

By contrast, non-teleological ID cannot make predictions at all, so it can only be supported as a deduction, which Meyer calls "the positive argument for design", i.e. 1. irreducible complexity can only be made by intelligent beings, 2. biology has irreducible complexity, so 3. biology was made by intelligent beings.

Only teleological ID can make predictions, but tele-ID is definitely religious. I'm not arguing that because tele-ID is religious, therefore it must be wrong. Tele-ID is wrong because like all theistic teleology, it's circular: let's wait for some atheist scientists using evolutionary assumptions to discover new functions in living organisms, and then after the atheists observe it, we'll say that we knew all along that that's how our God intended it to be.

Non-tele-ID can't make predictions and can't be tested even in principle, but at least in principle it could follow as a deduction. Whereas tele-ID is obviously religious, it's less immediately obvious that non-tele-ID is religious: you have to think to figure out where they slipped in God.

roger shrubber said...

http://www.ncbi.nlm.nih.gov/pubmed/2742922
Biokhimiia. 1989 Feb;54(2):187-200.
Role of the code redundancy in determining cotranslational protein folding

I recall earlier works but can't find one now. If I find some old Protein Society abstract books I'm pretty sure I can identify a slew of poster presentations that predate the above. The protein folding folks would argue about it, true or false, but usually over beer. In fact, the same people might rehash the argument the next night taking different sides provided there was still beer, and there was.

Unknown said...

Ok, I did my research. You're not a creationist (unless it was another roger shrubber), so what I tought it was, didn't fit in. I'm just gonna erase the comments, since they don't apply.

Unknown said...

Oh, my goodness, my expectations are so negative!

Anonymous said...
This comment has been removed by the author.
Unknown said...

I have negative expectations, and there are some reasons for that...

Anonymous said...
This comment has been removed by the author.
Unknown said...

That's what I was talking about...

Anonymous said...

What were you talking about exactly Miss?

Unknown said...

Reasons for having negative expectations.

Unknown said...

And this was my last response to the mutt that barks from the other side of the world.

Anonymous said...
This comment has been removed by the author.
roger shrubber said...

It looks like a missed a good laugh

Larry Moran said...

Thanks. I was rushing to get to an appointment at 4:30 and didn't proof before posting. Serves me right. (To be fair I sometimes make similar mistskes even after proofreading!)

Larry Moran said...

I'm pretty sure they've already predicted that last week so when they learn about it next week it will be another prediction that comes true. It reminds me of the predictions in the Bible that were written down after the events occurred.

Diogenes said...

Larry, someone on your blog is making sexually explicit comments about another commenter, referring to her nationality in a denigrating way, and accusing her of smoking dope based on her nationality. This is really beyond the beyond.

Isn't this shit grounds for insta-banning?

"You must be the girl with the polishing business. Last time I heard you were polishing some very sensitive equipment. "

Personally, I have ZERO tolerance for attacks on someone's nationality, or promotion of stereotypes, except as a joke in good spirits. It is one thing to kid Canadians about hockey and aboot, but these attacks on the Portuguese coming from Quest and Johnny must STOP. I mean no more references to batatas con whatever it is, no references to pot, NOTHING. STOP NOW. This is not my blog and I don't have the power to ban you but I swear to Jibbers Crabst the fire-breathing lobster beyond Saturn that you will be on my permanent shit list and I don't $%@king forget!

Now you drop it NOW. No Portugal, no pot, no polishing and no batatas. DROP IT.

DGA said...

I agree with Diogenes, this Johnny should go

Beau Stoddard said...

This whole blog is based on bashing others. I'm not saying I agree with Johnny but I'll be a monkeys uncle if this isn't irony at full strength. Correct if I'm wrong Diogenes but haven't you boasted of you're getting banned by ID/Creation cites? I know you believe it's because you've destroyed their feeble minds, I'm not sure they'd agree though. If I'm interfering in your attempt at chivalry I apologize.

Anonymous said...

Diogenes,

You are right. Sorry. Her bias was so obvious I just couldn't resist it.

But don't forget, if Larry really wanted to abide by some of the rules you've mentioned, you would have been banned long time ago.

Anonymous said...

Btw; in many European countries pot is legal as it is in many US states and soon in most of them. Toronto mayor was proud of his addictions and publicly stated that people who criticize him for those are just hypocrites.

colnago80 said...

Re Diogenes

Quest has already been banned.

Unknown said...

Hm... now the problem is my "bias". The problem here is creationism and creationist stupidity and proactive bullying on others.

Diogenes said...

Johnny, if I understand you, you claim MissAtheist provoked you by making some kind of offensive comments. This is possible, but since MA32 deleted some of her own comments before I saw them, I have no way of knowing. If MA32 provoked you, that would put your comments into context, but not justify them.

Anyway you said you're sorry, so I'll let it drop and eventually I'll delete my own comment flaming you.

peer said...

http://www.sciencedirect.com/science/article/pii/S0019103513000791

peer said...

The paper demonstrates that extraterrestrials (intelligent space aliens) would identify the terrestrial code as ID.

peer said...

There is nothing to discuss De atheists lose:

http://www.sciencedirect.com/science/article/pii/S0019103513000791

peer said...

It is now all scientfiically proven beyond doubt...

peer said...

Why was Quest banned...? He was nice...

Unknown said...

Offensive? What? The comments weren't even directed to him, were not offensive - more humurous than anything, and I just came in to conclusion that they didn't apply. But I guess I'm a bitchand a bully, so my version doesn't count.

Unknown said...

He's sorry? really? But the problem here is still my "bias", so...

peer said...

so the only thing left for them is bashing ...

Unknown said...

*Looking back, you don't need to take my word for it. Just see where my comment saying that and that I was going to delete the previous comment is. Is in response to somebody else's comment. How can I provoke someone if I'm not even talking to that person (or about that person)? Gosh!

Diogenes said...

This is waaay off topic but Beau says, "Correct if I'm wrong Diogenes but haven't you boasted of you're getting banned by ID/Creation cites?"

It's irrelevant, because I never 1. made sexually explicit comments about IDcreationists or speculated about their sexuality, or 2. attacked their nationality, nor have I tolerated other evolutuonists doing that to IDcreationists.

IDcreationist sites like UD maintain a double standard, which they sometimes admit to having and sometimes deny, whereby when they curse you out, call you names, insult you, physically threaten you, etc. they say these are not insults, but merely statements of fact, because you deserve it; but when we present facts showing that they consciously misrepresented scientific evidence, they scream "That's name-calling! It's a personal attack! You're 'uncivil.' You're banned!"

Barry Arrington has a rule, explicitly laid out at UD, that he, the moderator, will call evolutionists "liars" because they present facts inconvenient for his side; but evolutionists cannot call IDcreationists "liars" because that would be name calling.

This is why I say that, for IDcreationists, personal attacks are facts and thus permitted, but facts are personal attacks and thus not permitted.

At this blog, I once demonstrated this hypocrisy by copying a bunch of comments at other sites made by Joe Gallien, making the most obscene sexual comments and violent threats. It was all so obscene that Larry immediately deleted my comment. But Joe G gets to write top level posts at UD.

Barry also has a rule that he'll ban evolutionists from UD for stuff they write about ID or IDcreationists at other sites, any other site, not just UD. This is probably the reason for my first banning from UD, for stuff I wrote about Barry over here. Of course he never applies this rule to IDcreationists. He would never ban Joe G for sexual insults emitted outside UD.

Although IDcreationists say ID is not about religion, Barry will also ban you from UD for blaspheming against the Christian god.

I have not "boasted", but I have complained of being silently banned from UD 3 times and from most other creationist sites. My bannings from UD are all silent, no official reason is given, so I have to guess at the reason. The most likely reason for my last 2 bannings, I'd guess, is that O'Leary writes several posts a day wherein she sneers at and engages in name-calling towards the world's scientists, so I used to call her out for ignorantly not understanding the science stories upon which she was "reporting." Nobody else does that, so I guess criticizing O'Leary is not allowed.

Anonymous said...

It takes a lot of ignorance to think that the "article" you cite proves anything beyond doubt. If the problems were only scientific, but they go all the way to being pretty bad at the most basic philosophy. Poor logic does not start to describe it.

I'm not surprised by your enthusiasm though. You've been displaying astounding stupidity here since you started commenting. Arrogant stupidity.

Keep at it. If you weren't so arrogant in your ignorance it would be much harder to make fun of you. But the way you are, it feels just right.

roger shrubber said...

Well you did make some comment, either about me or my first post, and then thought better of what you wrote based on whether or not I was a creationist. Heck I didn't even make an argument, just dropped off a reference and mumbled something about scientists liking to debate ideas.
I am curious about what you wrote in response that depended on me as opposed to the words I donated. Sounds to me like you led with something inappropriate and then somebody else doubled down. And I get the impression you would not be apologetic if you decided I was a creationist. Think about that.

Anonymous said...

Diongenes,

Thank you for at least trying to see my point of view. I was wrong, I admitted and I apologized.

However, Is telling someone to f..k himself /herself a sexually explicit comment or does it depend on the definition of "sexually explicit comment"?

Do you see my point now?

Diogenes said...

Johnny says: "Is telling someone to f..k himself /herself a sexually explicit comment or does it depend on the definition of "sexually explicit comment"?

Yes, I think it is a valid point that "sexually comment" is not well-defined, given the widespread use of metaphorical language. I referred to your "sexually explicit" comment above when it would have been more correct for me to say "implicit." Still, I think there is a difference between comments of the form "this is what you do" and "this is what I'm telling you to do."

As for whether telling someone to $%^& themself is a sexual comment or a metaphorical one, if my auto mechanic makes my car worse when he should make it better, and I say, "Hey, you really $%^&ed up my car," we wouldn't normally call it a sexual comment. Rude of course.

But I admit there is a gray area and we should give some thought to where the boundaries ought to be. At the very least, whether "you go $%^& yourself" is allowed or disallowed, the same rule should apply to everybody.

For the record, Larry has threatened to ban me in the past for using the F-word, so I don't use it here (I do elsewhere *cough*.)

Diogenes said...

shCherbak's idiotic paper from two years ago, published in a journal Icarus which I never heard of before this, does not "demonstrate that extraterrestrials (intelligent space aliens) would identify the terrestrial code as ID." To the contrary, it tries to prove that extraterrestrials created the genetic code. It's the usual numerology gibberish, so beloved of ID proponents and Bible Code believers. He encodes the standard genetic code (ignoring all the variant codes) in the form of numbers and then searches for ways to add, subtract, and multiply the numbers until he makes a pattern that is non-random. Since it's non-random, he says it must be created by an intelligence. Of course the pattern was created by an intelligence... he created it, by cherry-picking a string of mathematical operations until he got a non-random result. He then announces he has found the number zero and a 10-based decimal numerical system symbolically represented in the genetic code. Of course, he created the number zero and the decimal system by cherry-picking his mathematical manipulations to get his predetermined result (shCherbak has a numerological obsession with decimal systems.) You could use some other mathematical operations and find a six-based system or a 12-based system or no system at all. Standard numerology.

He also idiotically asserts that the genetic code will persist over cosmological time scales and thus is the most permanent way of recording information. Idiotic. For one thing, we know there are variant genetic codes and that they evolved, so the GC is obviously not evolution-proof. For another, if you want a permanent way of recording information, just carve your message on a non-tectonic, non-volcanic, cold rocky planet or dwarf planet in letters 10 miles across.

The GC can "store" far less than log_2[ 20*64] bits of information because of the physicochemical constraint that most mutations need to be neutral, so it sucks as a way of storing information. The information shCherbak claims is "encoded" in the GC is, well, nothing, except that there's a non-random pattern. He doesn't find a message like a Shakespearean sonnet or the cure for cancer or "Take us to your leader", so why should we believe that any intelligence created it-- beside shCherbak himself?

Anonymous said...

Roger Shrubbery,
This is exactly the point I was trying to make and attempted to reason with Miss32 about it but she didn't connect. I try to be as neutral as possible in atheist/evolution vs religious/creationist debates and if I see bias as it was the case with Miss32 I usually attempt to point that out. It didn't work with her and her obvious ignorance made my blood boil.

Anonymous said...

It is a gray area I have to agree.

I would hope that one day the religious/creationists would be able to live in peace or at least communicate/debate in peaceful manner with atheist/evolution proponents. Am I too naive? Possibly

Mikkel Rumraket Rasmussen said...

Ignoring for a moment that paper is complete bullshit, I don't see the relevance of atheism. Supposing what the paper claims is really true and the genetic code was designed, how do you know it wasn't designed by aliens?

Anonymous said...

Peer,
Quest wasn't banned per say. He can still comment but Larry will remove his comments. Last time I saw his comment he said he was done here.
I saw a few of his comments @UD, but was quite a long time ago. At least I think it was him, because his comments were much, much nicer than here.

Unknown said...

"Oh, poor me... her ignorance is the problem... I was just pointing something out - I wasn't making any provocative remarks about how clever or not people were being. It had nothing to do with the fact that I was just a jerk to her for no good reason when she wasn't even directing her comments to me". Right.

Unknown said...

The problem is always someone else... Fine. I don't care. Whatever.

Unknown said...

"Oh, I'm sooo polite and humble, I apologized... But the problem here is still her - her ignorance, her... her... whatever. Not me. Never. Meanwhile, I'm sooo politically correct and I always find excuses"

Unknown said...

*"I wasn't making any provocative remarks about how clever or not people were being about hiding stuff about themselves. Because I'm not provokative at all and I'm not a bully like this atheists Pfff"

Anonymous said...

Miss32,

You did admit you were bulling quest, didn't you? Make up your mind then. Are you or aren't you a cyber bully?

Unknown said...

Make up your mind [and stop being so cunning and hijacking the atention to what happened a month ago]... weren't you a jerk for no reason?

Anonymous said...

Missy32,

I'm going to try to be very nice to you. However, there are problems.
1. It is obvious that 'the English language is your language of choice. Is it possible, I'm not trying to be rude, that the very few of the misunderstandings we've had are due to the lingual issue? Piotr may be the judge as the world's top linguist.

Unknown said...

Well, speaking, in the very least, for myself, you couldn't fool a fly into a water bottle, not even if your life depended on it. You're cunning and trying to clean your image just that.

Unknown said...

Roger:
«Well you did make some comment, either about me or my first post, and then thought better of what you wrote based on whether or not I was a creationist. Heck I didn't even make an argument, just dropped off a reference and mumbled something about scientists liking to debate ideas.
I am curious about what you wrote in response that depended on me as opposed to the words I donated.» - The context would be different if you were (it could be interpreted as a response to Larry if you were a creationist, but then it didn't made much sense (not even for a creationist). Now, I get along with some creationists. They are niceand polite. Not like here. It was about context and not about you being a creationist per se. Meanwhile, I think my comments were innapropriate in the new context, but, hell, if someone finds saying things (in a humurous way, I think) things like "now I lost my faith in mankind", I don't know what's offensive or "Innapropriate" anymore - I guess almost anything could be.

Unknown said...

Now, just as a end note: I didn't liked the way you just rushed into conclusions that I was the one at fault. In fact I hated. I think it's the last time I'll comment here.

roger shrubber said...

"lingual issue" Is that where somebody sticks their tongue out at somebody?

SRM said...

Sigh, I guess none of us can resist a rejoinder... but this site is so much better when it isnt dominated by chat room drama or the content-free provocations of peers, quests, and the like. I notice that when regulars from here visit UD, it is all about facts and they can demonstrate why IDers are wrong on a given point (eg 2ndLOT), but when IDers come here, it is all just pointless, endless, bluster and fluff.

SRM said...

By the way, Johnny is Quest and quite possibly Peer too.

peer said...

It is the tune that makes the music. As longh as Darwin-opposing scientists are named IDiots, fools, dumbheads, etc...

Of course you can give them a ban...in good ole Darwinian tradition...pretend there is no opposition.

What do yuo expect?

Anonymous said...

SRM, how did you figure it out? You must be a smart guy or something Don't forget that Barry Arrington is also Quest and Quest is Witton. Witton must be Peer then. And all you have to do is connect the dots to me somehow and prove it the way you proved it how you reassemble bacteria cells with broken cell membranes.

peer said...



And of course this is a bullshit paper, since it shows the mathematical (probably designed) symmetries in the terresrial code. All evidence pro ID has to be denied in your promissory materialsitic worldview.

An no I am not Quest. There are many of us left, despite the academic razzia.

Mikkel Rumraket Rasmussen said...

But you said there was NO way out, that "atheists lose" and there's "nothing to discuss".

Now you're agreeing we can't rule out space aliens. So you were wrong and my work here is done. Thanks for conceding.

Mikkel Rumraket Rasmussen said...

"It is now all scientfiically proven beyond doubt..."

That the genetic code was assembled by space aliens?

peer said...

This shows you are cherrypicking and do not understand the biology behind Cherbaks paper. The codons (not CG regions) are non-randomly dsdtibuted in two groups, which is independent of the numerology (all maths is in fact numerology as it is tautological). From this distribution, the logic is easy to follow for biologists (which are designed by the code having 10 fingers on eahc hand that are used for counting).

It is based on biochemical distributions that anticorrelate with code redundancy: the greater the redundancy the smaller the nucleon
number. You can not fiddle around with this and is thus not numerology in the sense of the bible code.

This promoted speculation is that prevailing small amino acids occupied the series of higher redundancy during the code evolution. So it is even evolutionary-driven.

GC scores (ischores) are now understood as regulatory sequences, higher structure DNA forming units. Is there anything you do know about biology?

I agree

peer said...

"For one thing, we know there are variant genetic codes and that they evolved.."

The point is that the ciode does not evolve. It is optimal and considered a frozen accident. The few minor variations found in for isntance mtDNA, are also optimal and function as secondary codes (for tagging purposes, differnetial control, etc).

peer said...

You cannot design a better code.

http://mbe.oxfordjournals.org/content/17/4/511.full

The code as it is, is nothing less than ID evidence (instead of evidence of common descent as it has been paraded).


Larry Moran said...

No matter what genetic code we ended up with, there would always be some imaginative scientist who could write a paper showing that it is the best possible code.

Mikkel Rumraket Rasmussen said...

What happened to your post, did you delete it?

Mikkel Rumraket Rasmussen said...

"You cannot design a better code."

Thank you for this blind faith statement which the link you give does not support(in fact it argues the direct opposite right there in the abstract), but the fact is that multiple scientists have independently shown that while the genetic code is very good, it is easy to come up with codes that are superior to the extant one in various aspects, such as robustness against the impact of mistranslation.

Why did you link a paper that shows the genetic code to be very good, but explicitly states already in the abstract that while better codes are very rare, they exist? Try reading without the god-goggle knob dialed to 11 next time.

Anonymous said...

You're not a scientist Peer. You're just some imbecile who pretends to pass for a scientist.

It's not opposition to Darwin that marks you as an idiot (and/or IDiot), but the idiotic ways of your opposition. Actual scientists have already shown that there's more to evolution than natural selection, and such things as junk DNA are "Darwin-opposing," yet not proposed by Idiots/IDiots. We have moved on beyond Darwin, while idiots like yourself are stuck with Darwin's name, and even then, you oppose it without understanding any of what that guy proposed. You're opposition is mere stupidity trying to pass for science.

Piotr Gąsiorowski said...

And LouiseG -- don't forget LouiseG.

Unknown said...

"ID, on the other hand, predicts that we should find deeper and deeper layers of function in biology. "

So does science. Unless we have reached the point where we have identified all of the functional bits of DNA in our genome. Which no scientist would suggest.

Anonymous said...

Who's LouiseG? Peer or Quest? Because as far as I can remember Peer identified himself here by his REAL first and last name as well as his religious membership. So how could he be LouiseG? Who is he?

Piotr Gąsiorowski said...

We all know who Peer is, and you, Johnny, know who LouiseG was. But I'm sick of all you sockpuppet trolls and won't feed you any longer.

Anonymous said...

If you know who peer Is why don't you challenge him with your superior knowledge and more so, evidence ? I mean how would you challenge someone if all you have is a guess work at best?

John Harshman said...

Oh, I get it: Johnny Quest. Cute.

SRM said...

Yes I thought it was probably intentional, although misspelled, since the cartoon name is Jonny Quest. Anyway, I have had my suspicions for some time for a variety of reasons, including facts that Johnny appeared around the time Quest disappeared and they both have similar argumentative styles. But last night I noticed something up thread. Everybody knows that Quest would always make a mockery of a person's name when responding to them. Then I noticed Johnny responding upthread to Roger Shrubber, where he called him Roger Shrubbery. A little too much Quest leaked out right there, I think.

John Harshman said...

Oh, what sad times are these when passing ruffians can say "ni" at will to old ladies. There is a pestilence upon this land, nothing is sacred.

roger shrubber said...

John, that's encroachment. Meanwhile, I'm expecting Hadji to show up soon.Race Bannan will set you right.

Anonymous said...

I took my time and reviewed old posts. I have a very good idea why Quest was "banned" and I can pretty much predict that the same can happen to Peer. Both of them have a lot of similarities but I'm 100% sure they are not the same person. Peer is YEC and Quest is OEC.

I couldn't find much on LouiseG except that he challenged latesuite who claims to be a psychiatrists.
I'm also pretty convinced that Quest can't be Witton, because Witton hated creationists both YEC and OEC.

I'm agnostic without any preference for now but do not respect people who claim that you are an idiot or IDiot because you challenge evolutionary science and abiogenesis. To me this is just bullying because of lack of evidence that the sciences should have. And it is not the God of the gap. It is the Darwin of the gaps as Peer and Quest would put it and that is why they were hated here.

Larry Moran said...

LouiseG was banned for making threats. That's the fastest way to get banned on Sandwalk. Dennis Markuze (Mabus) was also banned. There are no warnings.

You can also be banned if you write letters about me to any of my family members or any of my colleagues, including chairs, Deans, and Presidents of the university.

Quest was banned for excessive rudeness and swearing in spite of several warnings.

Witton was banned for spam and for welching on a $1000 bet.

So far, I've been pretty tolerant of spam but I'm rethinking that policy. I'm also thinking about banning people for just general stupidity and wasting my time but that would mean the end of almost all creationists and then what would we do on Sandwalk?

Diogenes said...

The reason why I accused Peer of being Quest is because in certain comments he was incoherent in exactly the Quest form of incoherence-- ellipses, trolling, accusing us of having never answered questions answered 1000 times, etc. However, in other comments Peer is as coherent as creationists can be, which is evidence of his not being Quest. But then in one thread Peer and Quest got into a mutual appreciation society, where Peer complimented Quest on his great intellect, wanted to be his friend, buy him a beer etc. Quest often gets into "conversations" with his sock puppets who tell him how great he is and they want to be friends. Note that the real creationists at UD do not fall all over Quest and compliment him on his keen intellect.

So how to reconcile conflicting data? I think Peer could be a real person whose logon ID was spoofed by Quest, who created a sock with the same name. There's nothing in the system to prevent you from spoofing other people's names. Quest did it to me once, created a sock with my name-- he even copied my avatar, badly-- and then wrote some moronic obscenities pretending to be Diogenes. So he could do it to Peer too.

LouiseG was definitely Quest.

We all thought Witton was Quest because Witton made bets and welched on them, Quest style, but especially because Quest once said that Witton was in jail. We asked Quest 400 times where he got that information, but he never answered and always just OTOLed (Off To the Origin of Life).

Piotr Gąsiorowski said...

Peer is a notorious Dutch creationist (Dr. P. B.) who has already been "outed" here. Peer Terborg is the anagram of his real name. He has nothing to do with John Witton & Co.

Judging from shared stylistic traits, lame grammar and recurrent motifs, John Witton, Quest, LouiseG and our new visitor Johnny are sockpuppets of one and the same troll. LouiseG used fewer ellipses than Witton or Quest, and Johnny avoids them completely (perhaps in an attempt to escape recognition), but otherwise they are virtually indistinguishable.

SRM said...

the frequent use of non sequiturs or statements or questions that are so ill-defined they cannot be understood is another commonality in the Questonian universe.

Mikkel Rumraket Rasmussen said...

Peer, Diogenes is using (GC) as an acronym for Genetic Code, not nucleotides. *facepalm*

Everything else you state doesn't change the fact that the authors were the ones who invented the pattern they come up with. There's nothing in the genetic code that tells you to add, or multiply, or count nucleons of biochemical derivatives of amino acids. Or which ones to add, or which ones to multiply, or which ones to subtract. The authors do this by searching and searching and searching to make a pattern, which is why THEY invent the pattern. There is no intrinsic pattern, it has to be created by the authors by fiddling around with what to do to make some sort of pattern. It's numerology, textbook fucking numerology.

SRM said...

Not so sure numerology should be discounted out of hand. By picking the first letter of random words out of Genesis I was able to assemble this peptide gene sequence.

ATGTACTACGCGTGGGAGCACATCTCCAAGATCAATGGGTAA

I then found that every one of these letters also appears in the Book of Revelation. After translating the sequence (I fell to my knees and wept at this point in my analysis), a BLASTp analysis demonstrated that among the highest hits, a desulferase (an obvious warning that god is the only path away from the fire and brimstone that awaits us) from Paludibacter propionicigenes came up. Note that Paludi means swamp, a reference to our current moral decay, and that the last part of the species name refers to Genesis, and the paradise we might have had here on earth if it wasn’t for disobeying.

Let you naysayers conclude I had too much time on my hands this Sunday morning, I am off to church where I can guarantee I will find an audience more receptive to my analysis. And I would publish my analysis in a reputable journal too, if it wasn’t for those atheistic reviewers.

Is all of this clever? Not really, but it doesn't need to be.

Mikkel Rumraket Rasmussen said...

You should publish it in Bio-Complexity.

Piotr Gąsiorowski said...

You can also try Icarus (Elsevier) or the Biosemiotics series (Springer). Who said that big science publishers were hostile to numerology?

The genetic code turns out to be a syntactic structure of arithmetic, the result of unique summations that have been carried out by some primordial abacus at least three and half billion years ago. The decimal place-value numerical system with a zero conception was used for that arithmetic. It turned out that the zero sign governed the genetic code not only as an integral part of the decimal system, but also directly as an acting arithmetical symbol. Being non-material abstractions, all the zero, decimal syntax and unique summations can display an artificial nature of the genetic code.

You can go on reading for only about $30.

steve oberski said...

You mean that they will pay you $30 to go on reading ?

Piotr Gąsiorowski said...

Even if they would, I'm not sure I'd accept the deal. What really puzzles me is how anyone whose IQ is not in the left-hand tail of the distribution could have accepted it for publication. Biosemiotics tries to look like a respectable series and it even has two scientific editors:

http://link.springer.com/bookseries/7710

steve oberski said...

The journal description:

the emerging field of biosemiotics proposes that animals, plants and single cells all engage in semiosis – the conversion of physical signals into conventional signs

certainly had my woo deflectors on full.

SRM said...

I think you need your post-modernist deflectors on too. Someone writing about the founder of semiotics, Charles Pierce:

“[Peirce]’s refusal to eliminate the acting subject along with the Cartesian cogito is one of the important respects in which Peirce’s semiotic vision is superior to the anti-humanist orientation of Saussure’s structuralist and poststructuralist offspring. For these offspring, the decentering of the subject amounts to nothing less than the liquidation of the agent; for Peirce, the repudiation of the Cartesian starting point means the recovery of flesh-and-blood actors who are continuously defining themselves through their give-and-take relationships with both the natural world and each other.”

http://home.mira.net/~andy/works/semiosis.htm

SRM said...

I rest my case.

Anonymous said...

What else can you do? Unless you can reassemble a cell all you can do is f...k yourself ...

Anonymous said...

.........

Unknown said...

So Johnny you have admitted being Witton. I went back to check the last discussion we had. There you were teaming up with John Harshman. I even responded to the two of you at the same time. Since John is a real person he cannot be your sockpuppet, but it makes me curious if it could be the other way around...

John Harshman said...

What? Me teaming up with Witton? You must be hallucinating.

Unknown said...

Well in this case the alter ego Johnny.

John Harshman said...

Whatever are you talking about?

Anonymous said...

I took Peer’s suggestion to read a 200 article testing whether the real genetic code is the best of all possible codes. (This isn’t the numerology article.)

After wrestling with definitions of “best,” “similar,” and “possible” as applied to this question so they can choose their methods, the authors report their results.

Under any assumptions, the actual code is extremely good. One in a million type good. Equally good or better codes are extremely rare. Nonetheless, there theoretically can be better codes. However, most of these probably can’t evolve given plausible evolutionary starting points for the code.

So, Peer states that there can be no better code based on an article that says there can be better codes but the actual genetic code may be the best one that could evolve under plausible conditions. I find that ironic.

Source: Freeland, Stephen J., Robin D. Knight, Laura F. Landweber, and Laurence D. Hurst. 2000. Early Fixation of an Optimal Genetic Code. Molecular Biology and Evolution 17(4): 551-518.

Unknown said...

So how did the genetic code evolve?

Anonymous said...

Hi Andy,

I don't know if scientists know how the genetic code evolved. I would therefore say that I don't know.

Given my ignorance, should we conclude that "God did it"?

Anonymous said...

I used cut and paste with some modification to post one of Quest's standard comments I found here but it has been removed since. Right after that "Mr. expert-linguist" posted his reassessment of writing styles and similarities bs. He made me laugh to tears that he fell for it.

Anonymous said...

I’ve also asked for details of the famous bet, which was also removed by Larry. Everyone who wants to find out the details of the bet can easily find it. I had done it before posting my request for details of the bet. I just wanted to see Larry’s reaction, which was exactly as I predicted.

Anonymous said...

I keep forgetting the most important part f..k........................................................................................................................................................................................................................................................................................................

Larry Moran said...

My favorite explanation of the evolution of the genetic code is the "Coevolution Theory" of my former colleague Jeff Wong [Coevolution theory of the genetic code at age thirty].

You can read a brief description at: Amino Acids and the Racemization "Problem" (scroll down)

steve oberski said...

Hey Andy,

Why is it that when a scientist says "I don't know" the IDiot interprets this as an admission of defeat but when the IDiot says this it's called faith ?

Anonymous said...

The problem is not necessarily the evolution of the genetic code but more so the arrival of the genetic code, which I'm sure is a piece of cake to explain without calling it the the Darwin of the gaps.................................................................................................................as Quest/Witton/Luis and other puppets would put it

Unknown said...

Thanks Larry. I had a quick look and will read it more carefully when I get a chance.

Anonymous said...

Don't be so much of an idiot Johnny. When a scientist doesn't know how something happened, then the scientist has a question. Maybe a field of research, if she can find a way to approach the problem, etc. That the problem should have a natural solution is default thinking, not because of any "Darwin of the gaps" as only imbeciles would put it, but because we know that natural processes exist. God-of-the-gaps arguments, on the other hand, rely entirely on thinking that when no solutions are obviously our there, that's a good place to put an imaginary being in charge, for no other reason than the person being inclined to believe that this imaginary being exists.

It must be quite frustrating for people like you that we don't consider gods as explanations, but you should understand that scientific explanations necessarily entail something better than imagining a magical being who does all the stuff. Science explains where "gods," besides being obviously imaginary, leave us naked and thirsty for some actual understanding.

Unknown said...

Photosynthesis, why do you think the scientific revolution took place in the Christian civilization and so many scientist have been devout Christians and Jews? We are all standing on the shoulders of giants, but some of us are to small to see it.

Anonymous said...

Hi Andy,

The answer is quite simple: cultural/historical happenstance.

Before the recent scientific revolution there was one in math and astronomy in the Muslim world. I doubt that you would claim that islam is necessary for math and astronomy. In any event, that Islam was not the reason for that knowledge revolution is evident when we consider that the revolution stopped when a fundamentalist group took power.

Today most scientists tend to be atheists. While I am convinced that atheism is a consequence of better scientific understanding, I would be far from claiming that atheism is the reason for science.

I understand that I stand on the shoulders of giants. Most of those giants are alive today, and most of them are atheists. Most of the foundational giants in my discipline are/were atheists (a few have died already). Yet. Maybe a giant here or there was Christian. Maybe I still owe something to Newton, or Kepler. Heck, even Darwin was somewhat religious. For all I care all of them could have drawn inspiration from their religious beliefs. If so, that does not mean that I have to buy into those fantasies. That does not mean that the religious beliefs were necessary for the science to happen.

Have a great week.

Arlin said...

With all due respect to Freeland, et al., I'm not too convinced. I'd be shocked if the genetic code is 1 in a 1000 of codes evolved without adaptation for codeyness. The first problem with all such studies is reflected in the hilariously long and direct title of a paper by di Diulio:

"The origin of the genetic code cannot be studied using measurements based on the PAM matrix because this matrix reflects the code itself, making any such analyses tautologous."

To measure the goodness of a code, you need a measure of amino acid exchangeability, and it better not be a code-biased measure. The problem is that even "biochemical" measures can be biased choices by virtue of post-hoc selection from (literally) hundreds of possible measures. This becomes very obvious if you look back at the literature from the 1960s. They tried a lot of different ideas with the goal of explaining *evolutionary* patterns. So, if "polarity" emerged historically in the literature as an important factor, then one needs to be suspicious of using it to measure code adaptedness. We looked at the code using a measure based on *experimental* exchanges (http://www.ncbi.nlm.nih.gov/pubmed/17896070), not biased by mutation, and it doesn't look as good as people say.

Second, the hypothesis that is not usually considered, and which is articulated in our paper, is that proposed mechanisms of code evolution, in the absence of any code-level optimization, will tend to produce correlation in neighboring pairings of codons with respect to amino acids (and vice versa), leading to orderliness that looks superficially adaptive but is not caused by adaptation. For instance, it is easier to change a new duplicated synthetase that recognizes amino acid X to recognize a similar amino acid X', and when the anticodon of the corresponding tRNA changes from recognizing one codon Y to another Y', the two codons will tend to be close. This can be understood partly as an effect of mutation (mutationally more likely to change to something close), and partly an effect of selection (better fit with stuff that is close), but this would be an entirely local kind of selection, *not* anything about the overall effect of the code's structure.

Anonymous said...

John Harshman,

You must have fucked up....
We're just liberating lovely people..... Are you in?

Anonymous said...

My favorite explanation of the evolution of the genetic code is the "Coevolution Theory" of my former colleague Jeff Wong

Right, and despite the number of years that have passed since he proposed it Jeff's theory stands up remarkably well.

Unknown said...

John, I suspect this already when I was new at this site a couple of years ago because of a post that appeared and was then removed. Similar to the one just before mine in this chain where Johnny was posting as Witton. It seems that either you are leaving a trail of bread crumbs or someone is trying to frame you. I mean, JOHN Witton, (JONNY) Quest, JOHNny...

John Harshman said...

Andy,

John has been the most common boy's name in the U.S. for a great many years. But are you also Andy Richter, Andy Summers, Raggedy Andy, and Andy of "Amos & Andy"? The similarity in names is uncanny.

In case that didn't get through, this: your suspicions are absurd, your reasoning is silly, and your claims are untrue. But I have come to expect this level of argument from you, so am not surprised.

Diogenes said...

Harshman, "Andy" is trolling you. "Andy" sounds a lot like Quest now, right? Recall that Quest accused me of being Jerry Coyne; now "Andy" is accusing you of being Johnny. Trolling.

I think Quest may be spoofing Andy Wilberforce, creating an account with his name and copying his avatar. Quest did it to me, creating an account named Diogenes and copying my avatar.

John Harshman said...

Poe's Law.

Unknown said...

John, your missing the point, probably on purpose, but I'll explain again anyway. There is a trail of bread crumbs, not conclusive, but enough to raise suspicion. I've mentioned three points here and I have a fourth that I will save for later. The name thing is not a big thing in itself, but you are the most active JOHN on this site, apart from Wittion, Quest and Johnny. I guess you know that Wilberforce isn't my real name, but Andy is. It's just convenient when making up a persona to keep some true facts. That's why I think we can be sure that whoever is behind W, Q & J is either named JOHN or is trying to implicate someone named JOHN.

John Harshman said...

Diogenes, Yeah, I think that's really Andy. Because people who create aliases always keep their real first names, and Quest's real first name isn't Andy. QED. I think he's serious, though of course Poe's Law still applies.

SRM said...

The suspense is killing us Andy.
Somehow I am reminded of a Twilight Zone episode, and this entire blog will dissolve into acrimony where everybody questions the identity of everyone else. And just who is this Larry Moran guy anyway... frankly, the name sounds made up.

Unknown said...

Well John, being the only Andy here it would have looked suspicious if the sockpuppets names would have been: Andy Witton, Raggedy and Andrew. But now that is not the case. Nor have I ever teamed up with any of them or had posts under their names.

John Harshman said...

Andy, you may choose to believe this or disbelieve it, depending on your level of paranoia: I have never posted anywhere under any name but my own.

Unknown said...

Ok John as Johnny wrote earlier in this thread: "I used cut and paste with some modification to post one of Quest's standard comments I found here but it has been removed since".
It's easy to fake a post, and if you remove it shortly after it's little risk of being caught and has the added advantage of looking extra suspect to whoever happens to see it.
So based on that and your reaction when confronted I give you the benefit of the doubt.

John Harshman said...

I have no idea what post you're referring to.

Larry Moran said...

It's time to stop this discussion.

peer said...

I really think many here are blind unable to read the literature:

http://www.ncbi.nlm.nih.gov/pubmed/10742043

Happy to lead them around.

peer said...

Yeah....junk DNA...no deeper levels. Science stopper.

peer said...

Evolutionism is nothing but a science stopper.

colnago80 said...

Re Terborg

Yeah, Laplace demonstrating that reference to god in connection with the stability of the Solar System was a proposition that he had no need of was a science stopper. Not.

Jmac said...

Welcome back Peer! I thought Larry banned all creationists from posting here so I was surprised to see your comments here.
However,
I do have to admit that your style of writing and attitude does resemble Wilton's but your areas of expertise are totally different. That's how I know you can't be the same person. So relax

peer said...
This comment has been removed by the author.
peer said...

I was easy to adapt,here...

It is like genomes: higly flexible, full of redundancy, full of VIGEs, ready to adapt and change within generations....due to huge INDEL mutations driven by VIGEs ...no millions of years required!

peer said...

"Peer is a notorious Dutch creationist (Dr. P. B.) who has already been "outed" here. Peer Terborg is the anagram of his real name. He has nothing to do with John Witton & Co."


Wrong. I am not only advocating evolution, I know that it occurs all the time...but the time frames must be adjusted.

The genomes are so highly flexible, frontloaded with machinery that makes adaptation and variation almost overnight events (in Dutsch tradion; de Vries mutation-theory, remember) .

It never occurred to anyone that if YECs need extremely high speed evolutionary mechanisms? They are in the genomes of all living organisms: VIGEs. Variation-inducing genetic elements. They induce rearrangements of the genome, INDELS, etc. There is no need for addition of new genes, neither for millions of years.

peer said...

"We have moved on beyond Darwin, while idiots like yourself are stuck with Darwin's name, and even then, you oppose it without understanding any of what that guy proposed. You're opposition is mere stupidity trying to pass for science."

The really pathetic thing is that your probably really believe that there is anything in addition to selection that might explain an increase of genomic information as must have taken place from microbe to man evolution.

There aren't.