Wednesday, November 20, 2013

Fred Sanger (1918-2013)

BBC News is reporting that Fred Sanger
has died [Frederick Sanger: Double Nobel Prize winner dies at 95]. Sanger is one of the few people to win two Nobel Prizes. His first was for sequencing insulin and his second was for developing a technique for sequencing DNA (Sanger sequencing).

Most people, even most scientists, have no idea how much he influenced molecular biology. Sanger worked at Cambridge (UK). When Francis Crick first arrived at Cambridge in 1947 he soon met a number of important scientists. Here's how Horace Freeland Judson describes Sanger in The Eight Day of Creation (pp. 88-89).
One of these in particular, the biochemist Frederick Sanger, came to have great intellectual importance in Crick's thinking and then to molecular biologists generally as the field developed. Sanger is temperamentally and in scientific style Crick's opposite. Where many scientists, Crick among them, flower at conferences and do a great deal of their science by talking, Singer is a quiet man—reticent, even shy, a man who worked with his hands, at the bench. He almost never talked to the press, never despite the editor's importuning wrote the big article for Scientific American. One might spot him bicycling to work on a spring morning, in a drab brown coat, in the rain. Once I stopped to talk with him in the corridor of the laboratory building, where he was waiting in the queue for his turn at the ultraviolet-light box, in order to illuminate the spots on a sheet of chromatography paper he was holding. Sanger is a Quaker by upbringing, and stayed at Cambridge through the second world war; holding only a junior fellowship in the biochemistry department, and even when the war dried up the usual sources of research funds, with family money he was able to keep going. In the course of nearly a decade, beginning in the mid-forties, Sanger settled upon the new techniques of chromatography to determine the amino-acid sequences of the two chains of the bovine insulin molecule. He proved that the sequences are unique and always the same, meaning that every molecule of insulin in every cow is exactly like every other. Yet the sequences show no general periodicities: they are not predictable from ordinary chemical rules.

Sanger published very rarely. His papers came to be red with heart in mouth by other scientists, for they are technically brilliant. Even as he worked, though, the news slowly spread and the implications sank in. For one thing, his department held a biochemistry tea club where perhaps once a month research that was relatively finished, though not yet submitted for publication, was presented. Brigitte Askonas, later an important figure in immunology in England, came to Sanger's lab as a doctoral student late in 1948, staying on into 1952. "Even then, Fred had only a minor fellowship—and some had wanted to kick him out," she told me once. "When one would ask him how his work was going, he would say very little. 'Oh, I've got another peptide.'" Then at a lab meeting he would bring a stack of cards showing overlapping short sequences, and slowly, diffidently, build up his latest segment of the molecule. "Crick always came to the tea club," Askonas said. "And he always asked awkward questions. Enfant terrible questions. And then he would explain, somewhat disingenuously, 'You see, I'm just learning.'" Sanger's general conclusion was forceful by 1949, when he went to the annual symposium on quantitative biology at Cold Spring Harbor (his only such visit). In a paper published on the first of June of that year—the earliest of his magisterial series of papers on insulin appearing every odd-numbered year until 1955—he was already able to say that "there appears to be no principle that defines the nature of the [amino-acid] residue" occupying any particular position in a protein. The conclusion was definitive by 1951. For this work and the methods of sequencing he invented to do it, Sanger was awarded the Nobel Prize in chemistry in 1958. (He later turned to the more difficult problem of sequencing nucleic acids, which earned him a share of another Nobel Prize, in 1980. Crick, from his first arrival in Cambridge, new of Sanger's work step by step, months and even years before new steps were published.


15 comments :

  1. Replies
    1. BBC is also reporting on another breaking news story, "Quest is confused."

      Delete
    2. I am... What do ya want me to say? I love your blog but this one is...Well...
      Maybe I was just emotional after watching the 'evolutionary" movie "Invictus" :)

      Delete
  2. Sanger was the first Ph.D. student of Albert Neuberger (1908-1996), whose second Ph.D. student was Rodney Porter of antibody fame. Nobby used to say: "My first Ph.D. student got two Nobel prizes. My second Ph.D. student got one Nobel prize. And it's been downhill all the way since then!"

    ReplyDelete
    Replies
    1. This apocryphal story is corrected by George Brownlee's fine biography of Sanger (2014). Actually, Porter was Sanger's first Ph.D. student at Cambridge. Porter then went to the National Institute of Medical Research, where Neuberger had previously located from Cambridge. Later, both men located to St. Mary's Hospital and then Porter went on to Oxford.

      Delete
  3. At least for ones we agree on something... Yahoooo!!! If you lived in Canada-I would invite you to celebrate this unique.... whatever.....Well, you are invited, still I think you might be a lot of fun...What do you think? Life of evolution is too short, too restricted, too boring, There seems to be no hope attached to it and I'm a hopeful guy...

    ReplyDelete
    Replies
    1. I think you should adjust your dosage. Up or down, I can't say.

      Delete
    2. I fully enjoyed the feeling of being like Robet B for a while...I went to this Eastern-European party and by the time a knew what was going on I had like 2-3 0.5 liter beers and the most amazing piroggies in the world..... It felt so good... after returning home I apparently wrote the shitty post.l...don't regret it.... because of my many previous posts .

      Anybody watched the movie "Invictus"? I had lived there in (SA) for few years so I think can relate to it ....Maybe you can't ..... In my view this movie is almost as true as it gets in Hollywood.....

      Delete
  4. Sadly, in America today (and I suspect elsewhere) Sanger's modus operandi would be completely impossible and he would have been thrown out directly and without hesitation. Instead of quietly doing transformative work and then winning two Nobel prizes, today you need to win the Nobel prizes first in order to be allowed to quietly do transformative work.

    ReplyDelete
  5. "Sanger published very rarely."

    Good thing (for science) that he wasn't living in today's scientific world

    ReplyDelete
    Replies
    1. Sounds like some did want to kick him out:
      "Even then, Fred had only a minor fellowship—and some had wanted to kick him out".

      Thank god(or chosen deity) he managed to stay on. Also noted this:
      "when the war dried up the usual sources of research funds, with family money he was able to keep going"

      Phew!

      cgcattccgtttcgcgaagatagcgcgaacggcgaacgc (transcribe > translate)

      Delete
    2. http://www.scientificamerican.com/article.cfm?id=frederick-sanger-father-of-dna-sequencing-dead-at-95&utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+sciam%2Fhealth-and-medicine+(Topic%3A+Health)

      Science journalist and regular Nature contributor Ed Yong has a rather cryptic tribute on his blog: “CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC.” This tool will help translate.

      “He was a superb hands-on scientist with outstanding judgement and skill, and an extremely modest yet encouraging way of interacting with his younger colleagues. I particularly remember one young scientist who had asked Fred for advice being told ‘I think you should try harder’.”

      http://www.independent.co.uk/news/science/father-of-the-genomics-and-only-briton-ever-to-win-two-nobel-prizes-fred-sanger-dies-8952069.html

      http://www.telegraph.co.uk/news/obituaries/science-obituaries/10462574/Frederick-Sanger-OM.html

      "This idea was controversial at the time as, although the 20 or so amino acids that can go to make up proteins were known, most scientists believed the arrangement of different amino acids in a protein to be random. One professor had even produced a complex mathematical formula that would express this random function. Thus, when Chibnall tried to get Sanger a grant from the Medical Research Council to work on protein structure, the grant was refused because “everyone knew” that the pattern of amino acids in a protein was random."

      Delete
    3. Timely to read Fred Sanger's essay in Nature Medicine (March 2001 7(3 )

      Delete